TIMM8A (NM_001145951) Human Untagged Clone
CAT＃: SC326516
TIMM8A (untagged)-Human translocase of inner mitochondrial membrane 8 homolog A (yeast) (TIMM8A), nuclear gene encoding mitochondrial protein, transcript variant 2, mRNA
CNY 3990.00
Product images
CNY 1999.00
CNY 2700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | DDP; DDP1; DFN1; MTS; TIM8 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001145951, the custom clone sequence may differ by one or more nucleotides
ATGGATTCCTCCTCCTCTTCCTCCGCGGCGGGTTTGGGTGCAGTGGACCCGCAGTTGCAG CATTTCATCGAGGTAGAGACTCAAAAGCAGCGCTTCCAGCAGCTGGTGCACCAGATGACT GAACTTTGTTGGGTTCCTGTGGCC |
| Restriction Sites | Please inquire |
| ACCN | NM_001145951 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001145951.1, NP_001139423.1 |
| RefSeq Size | 569 bp |
| RefSeq ORF | 147 bp |
| Locus ID | 1678 |
| Protein Families | Druggable Genome |
| Gene Summary | This translocase is involved in the import and insertion of hydrophobic membrane proteins from the cytoplasm into the mitochondrial inner membrane. The gene is mutated in Mohr-Tranebjaerg syndrome/Deafness Dystonia Syndrome (MTS/DDS) and it is postulated that MTS/DDS is a mitochondrial disease caused by a defective mitochondrial protein import system. Defects in this gene also cause Jensen syndrome; an X-linked disease with opticoacoustic nerve atrophy and muscle weakness. This protein, along with TIMM13, forms a 70 kDa heterohexamer. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Mar 2009] Transcript Variant: This variant (2) uses an alternate exon for its 3' terminus, compared to variant 1, which results in an isoform (2) with a shorter and distinct C-terminus, compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC226512 | TIMM8A (Myc-DDK-tagged)-Human translocase of inner mitochondrial membrane 8 homolog A (yeast) (TIMM8A), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 3990.00 |
|
| RC226512L3 | Lenti-ORF clone of TIMM8A (Myc-DDK-tagged)-Human translocase of inner mitochondrial membrane 8 homolog A (yeast) (TIMM8A), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 5890.00 |
|
| RC226512L4 | Lenti-ORF clone of TIMM8A (mGFP-tagged)-Human translocase of inner mitochondrial membrane 8 homolog A (yeast) (TIMM8A), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 5890.00 |
|
| RG226512 | TIMM8A (tGFP-tagged) - Human translocase of inner mitochondrial membrane 8 homolog A (yeast) (TIMM8A), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 4370.00 |
