COCH (NM_001135058) Human Untagged Clone

CAT#: SC326061

COCH (untagged)-Human coagulation factor C homolog, cochlin (Limulus polyphemus) (COCH), transcript variant 1



  "NM_001135058" in other vectors (4)

CNY 8840.00


货期*
2周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-COCH Antibody
    • 100 ul

CNY 5250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms COCH-5B2; COCH5B2; DFNA9; DFNB110
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001135058, the custom clone sequence may differ by one or more nucleotides


ATGTCCGCAGCCTGGATCCCGGCTCTCGGCCTCGGTGTGTGTCTGCTGCTGCTGCCGGGGCCCGCGGGCA
GCGAGGGAGCCGCTCCCATTGCTATCACATGTTTTACCAGAGGCTTGGACATCAGGAAAGAGAAAGCAGA
TGTCCTCTGCCCAGGGGGCTGCCCTCTTGAGGAATTCTCTGTGTATGGGAACATAGTATATGCTTCTGTA
TCGAGCATATGTGGGGCTGCTGTCCACAGGGGAGTAATCAGCAACTCAGGGGGACCTGTACGAGTCTATA
GCCTACCTGGTCGAGAAAACTATTCCTCAGTAGATGCCAATGGCATCCAGTCTCAAATGCTTTCTAGATG
GTCTGCTTCTTTCACAGTAACTAAAGGCAAAAGTAGTACACAGGAGGCCACAGGACAAGCAGTGTCCACA
GCACATCCACCAACAGGTAAACGACTAAAGAAAACACCCGAGAAGAAAACTGGCAATAAAGATTGTAAAG
CAGACATTGCATTTCTGATTGATGGAAGCTTTAATATTGGGCAGCGCCGATTTAATTTACAGAAGAATTT
TGTTGGAAAAGTGGCTCTAATGTTGGGAATTGGAACAGAAGGACCACATGTGGGCCTTGTTCAAGCCAGT
GAACATCCCAAAATAGAATTTTACTTGAAAAACTTTACATCAGCCAAAGATGTTTTGTTTGCCATAAAGG
AAGTAGGTTTCAGAGGGGGTAATTCCAATACAGGAAAAGCCTTGAAGCATACTGCTCAGAAATTCTTCAC
GGTAGATGCTGGAGTAAGAAAAGGGATCCCCAAAGTGGTGGTGGTATTTATTGATGGTTGGCCTTCTGAT
GACATCGAGGAAGCAGGCATTGTGGCCAGAGAGTTTGGTGTCAATGTATTTATAGTTTCTGTGGCCAAGC
CTATCCCTGAAGAACTGGGGATGGTTCAGGATGTCACATTTGTTGACAAGGCTGTCTGTCGGAATAATGG
CTTCTTCTCTTACCACATGCCCAACTGGTTTGGCACCACAAAATACGTAAAGCCTCTGGTACAGAAGCTG
TGCACTCATGAACAAATGATGTGCAGCAAGACCTGTTATAACTCAGTGAACATTGCCTTTCTAATTGATG
GCTCCAGCAGTGTTGGAGATAGCAATTTCCGCCTCATGCTTGAATTTGTTTCCAACATAGCCAAGACTTT
TGAAATCTCGGACATTGGTGCCAAGATAGCTGCTGTACAGTTTACTTATGATCAGCGCACGGAGTTCAGT
TTCACTGACTATAGCACCAAAGAGAATGTCCTAGCTGTCATCAGAAACATCCGCTATATGAGTGGTGGAA
CAGCTACTGGTGATGCCATTTCCTTCACTGTTAGAAATGTGTTTGGCCCTATAAGGGAGAGCCCCAACAA
GAACTTCCTAGTAATTGTCACAGATGGGCAGTCCTATGATGATGTCCAAGGCCCTGCAGCTGCTGCACAT
GATGCAGGAATCACTATCTTCTCTGTTGGTGTGGCTTGGGCACCTCTGGATGACCTGAAAGATATGGCTT
CTAAACCGAAGGAGTCTCATGCTTTCTTCACAAGAGAGTTCACAGGATTAGAACCAATTGTTTCTGATGT
CATCAGAGGCATTTGTAGAGATTTCTTAGAATCCCAGCAATAA


Restriction Sites Please inquire     
ACCN NM_001135058
Insert Size 2100 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001135058.1, NP_001128530.1
RefSeq Size 2882 bp
RefSeq ORF 1653 bp
Locus ID 1690
UniProt ID O43405
Gene Summary The protein encoded by this gene is highly conserved in human, mouse, and chicken, showing 94% and 79% amino acid identity of human to mouse and chicken sequences, respectively. Hybridization to this gene was detected in spindle-shaped cells located along nerve fibers between the auditory ganglion and sensory epithelium. These cells accompany neurites at the habenula perforata, the opening through which neurites extend to innervate hair cells. This and the pattern of expression of this gene in chicken inner ear paralleled the histologic findings of acidophilic deposits, consistent with mucopolysaccharide ground substance, in temporal bones from DFNA9 (autosomal dominant nonsyndromic sensorineural deafness 9) patients. Mutations that cause DFNA9 have been reported in this gene. Alternative splicing results in multiple transcript variants encoding the same protein. Additional splice variants encoding distinct isoforms have been described but their biological validities have not been demonstrated. [provided by RefSeq, Oct 2008]
Transcript Variant: This variant (1) uses an alternate in-frame splice junction in the 5' end compared to variant 3. The resulting isoform (b) has the same N- and C-termini but is shorter compared to isoform a. Variants 1 and 2 encode the same isoform (b).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...