XPD (ERCC2) (NM_001130867) Human Untagged Clone

CAT#: SC325890

ERCC2 (untagged)-Human excision repair cross-complementing rodent repair deficiency, complementation group 2 (ERCC2), transcript variant 2



  "NM_001130867" in other vectors (4)

CNY 6560.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
ERCC2 mouse monoclonal antibody, clone OTI4B11 (formerly 4B11)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms COFS2; EM9; TFIIH; TTD; TTD1; XPD
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC325890 representing NM_001130867.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCGGGAGCTCAAACGCACGCTGGACGCCAAGGGTCATGGAGTCCTGGAGATGCCCTCAGGCACCGGG
AAGACAGTATCCCTGTTGGCCCTGATCATGGCATACCAGAGAGCATATCCGCTGGAGGTGACCAAACTC
ATCTACTGCTCAAGAACTGTGCCAGAGATTGAGAAGGTGATTGAAGAGCTTCGAAAGTTGCTCAACTTC
TATGAGAAGCAGGAGGGCGAGAAGCTGCCGTTTCTGGGACTGGCTCTGAGCTCCCGCAAAAACTTGTGT
ATTCACCCTGAGGTGACACCCCTGCGCTTTGGGAAGGACGTCGATGGGAAATGCCACAGCCTCACAGCC
TCCTATGTGCGGGCGCAGTACCAGCATGACACCAGCCTGCCCCACTGCCGATTCTATGAGGAATTTGAT
GCCCATGGGCGTGAGGTGCCCCTCCCCGCTGGCATCTACAACCTGGATGACCTGAAGGCCCTGGGGCGG
CGCCAGGGCTGGTGCCCATACTTCCTTGCTCGATACTCAATCCTGCATGCCAATGTGGTGGTTTATAGC
TACCACTACCTCCTGGACCCCAAGATTGCAGACCTGGTGTCCAAGGAACTGGCCCGCAAGGCCGTCGTG
GTCTTCGACGAGGCCCACAACATTGACAACGTCTGCATCGACTCCATGAGCGTCAACCTCACCCGCCGG
ACCCTTGACCGGTGCCAGGGCAACCTGGAGACCCTGCAGAAGACGGTGCTCAGGATCAAAGAGACAGAC
GAGCAGCGCCTGCGGGACGAGTACCGGCGTCTGGTGGAGGGGCTGCGGGAGGCCAGCGCCGCCCGGGAG
ACGGACGCCCACCTGGCCAACCCCGTGCTGCCCGACGAAGTGCTGCAGGAGGCAGTGCCTGGCTCCATC
CGCACGGCCGAGCATTTCCTGGGCTTCCTGAGGCGGCTGCTGGAGTACGTGAAGTGGCGGCTGCGTGTG
CAGCATGTGGTGCAGGAGAGCCCGCCCGCCTTCCTGAGCGGCCTGGCCCAGCGCGTGTGCATCCAGCGC
AAGCCCCTCAGATTCTGTGCTGAACGCCTCCGGTCCCTGCTGCATACTCTGGAGATCACCGACCTTGCT
GACTTCTCCCCGCTCACCCTCCTTGCTAACTTTGCCACCCTTGTCAGCACCTACGCCAAAGGCCAGGCT
CAGCACTGTGGAAGCAGCAGGAACCAAAAAAGATCTCATCCCTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001130867
Insert Size 1218 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001130867.1
RefSeq Size 1753 bp
RefSeq ORF 1218 bp
Locus ID 2068
UniProt ID P18074
Protein Families Druggable Genome, Transcription Factors
Protein Pathways Nucleotide excision repair
MW 46.3 kDa
Gene Summary The nucleotide excision repair pathway is a mechanism to repair damage to DNA. The protein encoded by this gene is involved in transcription-coupled nucleotide excision repair and is an integral member of the basal transcription factor BTF2/TFIIH complex. The gene product has ATP-dependent DNA helicase activity and belongs to the RAD3/XPD subfamily of helicases. Defects in this gene can result in three different disorders, the cancer-prone syndrome xeroderma pigmentosum complementation group D, trichothiodystrophy, and Cockayne syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
Transcript Variant: This variant (2) has an additional segment in the 5' region, which results in a downstream AUG start codon, and lacks multiple 3' exons but has an alternate 3' exon, as compared to variant 1. The resulting isoform (2) has a shorter N-terminus and a distinct and shorter C-terminus, as compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...