HTR3D (NM_001145143) Human Untagged Clone

CAT#: SC325889

HTR3D (untagged)-Human 5-hydroxytryptamine (serotonin) receptor 3 family member D (HTR3D), transcript variant 1



  "NM_001145143" in other vectors (4)

CNY 6560.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit polyclonal anti-HTR3D antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms 5HT3D
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC325889 representing NM_001145143.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAAAGAGGCTGGTTCCATGGGAAAGGATTCCTCCTTGGCTTCATCCTCCACCTGCTGCTGCAAGAT
TCACACCTTCAACTGGTGACATCGTTCCTGTGGCTAAATATGTGGAACCCAGATGAATGCGGAGGCATC
AAGAAGTCCGGCATGGCAACTGAGAACCTATGGCTTTCAGATGTCTTCATCGAGGAGTCTGTGGATCAG
ACACCTGCAGGTCTCATGGCTAGTATGTCAATAGTGAAGGCCACATCAAACACAATAAGCCAATGTGGG
TGGTCAGCATCTGCAAACTGGACACCTTCTATTTCCCCTTCCATGGACAGAGGTGAACGCTCTCCTTCA
GCCCTTTCACCTACACAGGTAACCCGGGCATGGAGAAGGATGTCCAGGAGCTTTCAAATACATCACAGA
ACCTCATTCAGAACAAGGAGGGAGTGGGTACTGCTGGGTATCCAAAAAAGAACAATAAAGGTGACCGTG
GCCACTAACCAGTATGAACAAGCCATCTTCCATGTGGCCATCAGGCGCAGGTGCAGGCCCAGCCCCTAC
GTGGTAAACTTTCTGGTGCCCAGTGGCATTCTGATTGCCATCGATGCCCTCAGTTTCTACCTGCCACTG
GAAAGTGGGAATTGTGCCCCATTCAAGATGACTGTTCTGCTGGGCTACAGCGTCTTCCTGCTCATGATG
AATGACTTGCTCCCAGCCACTAGCACTTCATCACATGCTTCACTAGTACGTCCTCATCCATCAAGAGAC
CAAAAGCGAGGTGTCTACTTCGCCCTGTGCCTGTCCCTGATGGTGGGCAGCCTGCTGGAGACCATCTTC
ATCACCCACCTGCTGCACGTGGCCACCACCCAGCCCCTACCTCTGCCTCGGTGGCTCCACTCCCTGCTG
CTGCACTGCACCGGCCAAGGGAGATGCTGTCCCACTGCGCCCCAGAAGGGAAATAAGGGCCCGGGTCTC
ACCCCCACCCACCTGCCCGGTGTGAAGGAGCCAGAGGTATCAGCAGGGCAGATGCCAGGCCCTGGGGAG
GCAGAGCTGACAGGGGGCTCAGAATGGACAAGGGCCCAGCGGGAACACGAGGCCCAGAAGCAGCACTCG
GTGGAGCTGTGGGTGCAGTTCAGCCACGCGATGGACGCCCTGCTCTTCCGCCTCTACCTGCTCTTCATG
GCCTCCTCCATCATCACCGTCATATGCCTCTGGAACACCTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001145143
Insert Size 1215 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001145143.1
RefSeq Size 1609 bp
RefSeq ORF 1215 bp
Locus ID 200909
UniProt ID Q70Z44
Protein Families Druggable Genome, Ion Channels: Cys-loop Receptors, Transmembrane
MW 45.1 kDa
Gene Summary The protein encoded this gene belongs to the ligand-gated ion channel receptor superfamily. This gene encodes subunit D of the type 3 receptor for 5-hydroxytryptamine (serotonin), a biogenic hormone that functions as a neurotransmitter, a mitogen and a hormone. This hormone has been linked to neuropsychiatric disorders, including anxiety, depression, and migraine. Serotonin receptors causes fast and depolarizing responses in neurons following activation. The genes encoding subunits C, D and E of this type 3 receptor form a cluster on chromosome 3. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]
Transcript Variant: This variant (1) differs in the 5' coding region, compared to variant 3, resulting in an isoform (1) that is shorter than isoform 3. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...