TCF7 (NM_001134851) Human Untagged Clone
CAT#: SC325832
TCF7 (untagged)-Human transcription factor 7 (T-cell specific, HMG-box) (TCF7), transcript variant 3
CNY 6270.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | TCF-1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC325832 representing NM_001134851.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTACAAAGAGACCGTCTACTCCGCCTTCAATCTGCTCATGCATTACCCACCCCCCTCGGGAGCAGGG CAGCACCCCCAGCCGCAGCCCCCGCTGCACAAGGCCAATCAGCCCCCCCACGGTGTCCCCCAACTCTCT CTCTACGAACATTTCAACAGCCCACATCCCACCCCTGCACCTGCGGACATCAGCCAGAAGCAAGTTCAC AGGCCTCTGCAGACCCCTGACCTCTCTGGCTTCTACTCCCTGACCTCAGGCAGCATGGGGCAGCTCCCC CACACTGTGAGCTGGTTCACCCACCCATCCTTGATGCTAGGTTCTGGTGTACCTGGTCACCCAGCAGCC ATCCCCCACCCGGCCATTGTGCCCCCCTCAGGGAAGCAGGAGCTGCAGCCCTTCGACCGCAACCTGAAG ACACAAGCAGAGTCCAAGGCAGAGAAGGAGGCCAAGAAGCCAACCATCAAGAAGCCCCTCAATGCCTTC ATGCTGTACATGAAGGAGATGAGAGCCAAGGTCATTGCAGAGTGCACACTTAAGGAGAGCGCTGCCATC AACCAGATCCTGGGCCGCAGGTGGCACGCGCTGTCGCGAGAAGAGCAGGCCAAGTACTATGAGCTGGCC CGCAAGGAGAGGCAGCTGCACATGCAGCTATACCCAGGCTGGTCAGCGCGGGACAACTACGGGAAGAAG AAGAGGCGGTCGAGGGAAAAGCACCAAGAATCCACCACAGAGACAAACTGGCCCAGAGAACTCAAGGAT GGTAATGGACAAGAGTCACTGTCCATGTCTTCTTCCTCTAGCCCAGCTTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001134851 |
Insert Size | 810 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001134851.2 |
RefSeq Size | 3322 bp |
RefSeq ORF | 810 bp |
Locus ID | 6932 |
UniProt ID | P36402 |
Protein Families | Druggable Genome, ES Cell Differentiation/IPS, Transcription Factors |
Protein Pathways | Acute myeloid leukemia, Adherens junction, Arrhythmogenic right ventricular cardiomyopathy (ARVC), Basal cell carcinoma, Colorectal cancer, Endometrial cancer, Melanogenesis, Pathways in cancer, Prostate cancer, Thyroid cancer, Wnt signaling pathway |
MW | 30.3 kDa |
Gene Summary | This gene encodes a member of the T-cell factor/lymphoid enhancer-binding factor family of high mobility group (HMG) box transcriptional activators. This gene is expressed predominantly in T-cells and plays a critical role in natural killer cell and innate lymphoid cell development. The encoded protein forms a complex with beta-catenin and activates transcription through a Wnt/beta-catenin signaling pathway. Mice with a knockout of this gene are viable and fertile, but display a block in T-lymphocyte differentiation. Alternative splicing results in multiple transcript variants. Naturally-occurring isoforms lacking the N-terminal beta-catenin interaction domain may act as dominant negative regulators of Wnt signaling. [provided by RefSeq, Oct 2016] Transcript Variant: This variant (3, also known as A), differs in the 5' UTR, has multiple coding region differences, uses a downstream start codon, and differs in the 3' UTR, compared to variant 1. The resulting isoform (3) is shorter at the N-terminus and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225556 | TCF7 (Myc-DDK-tagged)-Human transcription factor 7 (T-cell specific, HMG-box) (TCF7), transcript variant 3 |
CNY 3656.00 |
|
RC225556L3 | Lenti-ORF clone of TCF7 (Myc-DDK-tagged)-Human transcription factor 7 (T-cell specific, HMG-box) (TCF7), transcript variant 3 |
CNY 6056.00 |
|
RC225556L4 | Lenti-ORF clone of TCF7 (mGFP-tagged)-Human transcription factor 7 (T-cell specific, HMG-box) (TCF7), transcript variant 3 |
CNY 5890.00 |
|
RG225556 | TCF7 (tGFP-tagged) - Human transcription factor 7 (T-cell specific, HMG-box) (TCF7), transcript variant 3 |
CNY 4370.00 |