DEK (NM_001134709) Human Untagged Clone

CAT#: SC325794

DEK (untagged)-Human DEK oncogene (DEK), transcript variant 2



  "NM_001134709" in other vectors (6)

CNY 5510.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal DEK Antibody
    • 100 ug

CNY 5302.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms D6S231E
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC325794 representing NM_001134709.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCCGCCTCGGCCCCTGCTGCGGAGGGGGAGGGAACCCCCACCCAGCCCGCGTCCGAGAAAGAACCC
GAAATGCCCGGTCCCAGAGAGGAGAGCGAGGAGGAAGAGGACGAGGACGACGAGGAGGAGGAGGAGGAG
GAAAAAGGAAAGGGGCAGAAACTTTGTGAAATTGAGAGGATACATTTTTTTCTAAGTAAGAAGAAAACC
GATGAACTTAGAAATCTACACAAACTGCTTTACAACAGGCCAGGCACTGTGTCCTCATTAAAGAAGAAT
GTGGGTCAGTTCAGTGGCTTTCCATTTGAAAAAGGAAGTGTCCAATATAAAAAGAAGGAAGAAATGTTG
AAAAAATTTAGAAATGCCATGTTAAAGAGCATCTGTGAGGTTCTTGATTTGGAGAGATCAGGTGTAAAT
AGTGAACTAGTGAAGAGGATCTTGAATTTCTTAATGCATCCAAAGCCTTCTGGCAAACCATTGCCGAAA
TCTAAAAAAACTTGTAGCAAAGGCAGTAAAAAGGAACGGAACAGTTCTGGAATGGCAAGGAAGGCTAAG
CGAACCAAATGTCCTGAAATTCTGTCAGATGAATCTAGTAGTGATGAAGATGAAAAGAAAAACAAGGAA
GAGTCTTCAGATGATGAAGATAAAGAAAGTGAAGAGGAGCCACCAAAAAAGACAGCCAAAAGAGAAAAA
CCTAAACAGAAAGCTACTTCTAAAAGTAAAAAATCTGTGAAAAGTGCCAATGTTAAGAAAGCAGATAGC
AGCACCACCAAGAAGAATCAAAACAGTTCCAAAAAAGAAAGTGAGTCTGAGGATAGTTCAGATGATGAA
CCTTTAATTAAAAAGTTGAAGAAACCCCCTACAGATGAAGAGTTAAAGGAAACAATAAAGAAATTACTG
GCCAGTGCTAACTTGGAAGAAGTCACAATGAAACAGATTTGCAAAAAGGTCTATGAAAATTATCCTACT
TATGATTTAACTGAAAGAAAAGATTTCATAAAAACAACTGTAAAAGAGCTAATTTCTTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001134709
Insert Size 1026 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001134709.1
RefSeq Size 2785 bp
RefSeq ORF 1026 bp
Locus ID 7913
UniProt ID P35659
Protein Families Druggable Genome, Transcription Factors
MW 38.7 kDa
Gene Summary This gene encodes a protein with one SAP domain. This protein binds to cruciform and superhelical DNA and induces positive supercoils into closed circular DNA, and is also involved in splice site selection during mRNA processing. Chromosomal aberrations involving this region, increased expression of this gene, and the presence of antibodies against this protein are all associated with various diseases. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
Transcript Variant: This variant (2) lacks an alternate in-frame exon in the 5' coding region, compared to variant 1. The resulting isoform (2) is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...