MDM2 (NM_001145340) Human Untagged Clone
CAT#: SC325727
MDM2 (untagged)-Human Mdm2 p53 binding protein homolog (mouse) (MDM2), transcript variant MDM2i
CNY 6270.00
Product images

CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ACTFS; hdm2; HDMX; LSKB |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC325727 representing NM_001145340.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTGCAATACCAACATGTCTGTACCTACTGATGGTGCTGTAACCACCTCACAGATTCCAGCTTCGGAA CAAGAGACCCTGGTTAGACCAAAGCCATTGCTTTTGAAGTTATTAAAGTCTGTTGGTGCACAAAAAGAC ACTTATACTATGAAAGAGGATCTTGATGCTGGTGTAAGTGAACATTCAGGTGATTGGTTGGATCAGGAT TCAGTTTCAGATCAGTTTAGTGTAGAATTTGAAGTTGAATCTCTCGACTCAGAAGATTATAGCCTTAGT GAAGAAGGACAAGAACTCTCAGATGAAGATGATGAGGACTATTGGAAATGCACTTCATGCAATGAAATG AATCCCCCCCTTCCATCACATTGCAACAGATGTTGGGCCCTTCGTGAGAATTGGCTTCCTGAAGATAAA GGGAAAGATAAAGGGGAAATCTCTGAGAAAGCCAAACTGGAAAACTCAACACAAGCTGAAGAGGGCTTT GATGTTCCTGATTGTAAAAAAACTATAGTGAATGATTCCAGAGAGTCATGTGTTGAGGAAAATGATGAT AAAATTACACAAGCTTCACAATCACAAGAAAGTGAAGACTATTCTCAGCCATCAACTTCTAGTAGCATT ATTTATAGCAGCCAAGAAGATGTGAAAGAGTTTGAAAGGGAAGAAACCCAAGACAAAGAAGAGAGTGTG GAATCTAGTTTGCCCCTTAATGCCATTGAACCTTGTGTGATTTGTCAAGGTCGACCTAAAAATGGTTGC ATTGTCCATGGCAAAACAGGACATCTTATGGCCTGCTTTACATGTGCAAAGAAGCTAAAGAAAAGGAAT AAGCCCTGCCCAGTATGTAGACAACCAATTCAAATGATTGTGCTAACTTATTTCCCCTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001145340 |
Insert Size | 888 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001145340.2 |
RefSeq Size | 6657 bp |
RefSeq ORF | 888 bp |
Locus ID | 4193 |
Protein Families | Druggable Genome, Transcription Factors |
Protein Pathways | Bladder cancer, Cell cycle, Chronic myeloid leukemia, Endocytosis, Glioma, Melanoma, p53 signaling pathway, Pathways in cancer, Prostate cancer, Ubiquitin mediated proteolysis |
MW | 33.1 kDa |
Gene Summary | This gene encodes a nuclear-localized E3 ubiquitin ligase. The encoded protein can promote tumor formation by targeting tumor suppressor proteins, such as p53, for proteasomal degradation. This gene is itself transcriptionally-regulated by p53. Overexpression or amplification of this locus is detected in a variety of different cancers. There is a pseudogene for this gene on chromosome 2. Alternative splicing results in a multitude of transcript variants, many of which may be expressed only in tumor cells. [provided by RefSeq, Jun 2013] Transcript Variant: This variant (4, also known as P2-MDM2-C1) contains multiple differences in the 5' UTR and coding region, compared to variant 1. It uses an alternate promoter and initiates translation at a downstream in-frame start codon. The encoded isoform (i) has a shorter N-terminus and is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227676 | MDM2 (Myc-DDK-tagged)-Human Mdm2 p53 binding protein homolog (mouse) (MDM2), transcript variant MDM2i |
CNY 2400.00 |
|
RC227676L3 | Lenti ORF clone of Human Mdm2 p53 binding protein homolog (mouse) (MDM2), transcript variant MDM2i, Myc-DDK-tagged |
CNY 5890.00 |
|
RC227676L4 | Lenti ORF clone of Human Mdm2 p53 binding protein homolog (mouse) (MDM2), transcript variant MDM2i, mGFP tagged |
CNY 5890.00 |
|
RG227676 | MDM2 (tGFP-tagged) - Human Mdm2 p53 binding protein homolog (mouse) (MDM2), transcript variant MDM2i |
CNY 4370.00 |