NIPA1 (NM_001142275) Human Untagged Clone
CAT#: SC325674
NIPA1 (untagged)-Human non imprinted in Prader-Willi/Angelman syndrome 1 (NIPA1), transcript variant 2
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | FSP3; SLC57A1; SPG6 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC325674 representing NM_001142275.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCTGTTGGCCAGATTGGAAACTTCCTGGCTTACACGGCGGTCCCCACGGTCCTGGTAACCCCCCTG GGCGCCCTTGGAGTACCGTTCGGGTCCATTTTAGCTTCCTATCTCCTGAAGGAAAAGCTCAACATCTTG GGCAAGTTGGGGTGCCTGCTAAGCTGTGCAGGCTCCGTCGTGCTGATTATCCACTCCCCAAAGTCTGAG AGTGTGACAACTCAGGCTGAGCTGGAGGAAAAGCTGACCAATCCAGTGTTTGTGGGCTACCTGTGCATC GTGCTGCTCATGCTGCTGCTGCTCATCTTCTGGATCGCGCCGGCCCATGGGCCCACCAACATCATGGTC TACATCAGCATCTGCTCCTTGCTGGGCAGTTTCACCGTGCCTTCCACCAAGGGCATCGGGCTGGCGGCC CAAGACATCTTGCATAACAACCCGTCCAGTCAGAGAGCCCTCTGCCTGTGCCTGGTACTCCTGGCCGTG CTCGGCTGCAGCATCATCGTCCAGTTCAGGTACATCAACAAGGCGCTGGAGTGCTTCGACTCCTCGGTG TTCGGGGCCATCTACTACGTCGTGTTTACCACGCTGGTCCTGCTGGCCTCAGCCATCCTCTTCCGGGAG TGGAGCAACGTGGGCCTGGTGGACTTCTTGGGGATGGCCTGTGGATTCACGACCGTCTCCGTGGGGATT GTCCTTATACAGGTGTTCAAAGAGTTCAATTTCAACCTTGGGGAGATGAACAAATCTAATATGAAAACA GACTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001142275 |
| Insert Size | 765 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001142275.1 |
| RefSeq Size | 6386 bp |
| RefSeq ORF | 765 bp |
| Locus ID | 123606 |
| UniProt ID | Q7RTP0 |
| Protein Families | Druggable Genome, Transmembrane |
| MW | 27.3 kDa |
| Gene Summary | This gene encodes a magnesium transporter that associates with early endosomes and the cell surface in a variety of neuronal and epithelial cells. This protein may play a role in nervous system development and maintenance. Multiple transcript variants encoding different isoforms have been found for this gene. Mutations in this gene have been associated with autosomal dominant spastic paraplegia 6. [provided by RefSeq, Nov 2008] Transcript Variant: This variant (2) uses an alternate 5' exon and downstream start codon, compared to variant 1. The resulting protein (isoform 2) has a shorter N-terminus, compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC227903 | NIPA1 (Myc-DDK-tagged)-Human non imprinted in Prader-Willi/Angelman syndrome 1 (NIPA1), transcript variant 2 |
CNY 2400.00 |
|
| RC227903L3 | Lenti ORF clone of Human non imprinted in Prader-Willi/Angelman syndrome 1 (NIPA1), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC227903L4 | Lenti ORF clone of Human non imprinted in Prader-Willi/Angelman syndrome 1 (NIPA1), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
| RG227903 | NIPA1 (tGFP-tagged) - Human non imprinted in Prader-Willi/Angelman syndrome 1 (NIPA1), transcript variant 2 |
CNY 4370.00 |
