RIZ1 (PRDM2) (NM_001135610) Human Untagged Clone
CAT#: SC325626
PRDM2 (untagged)-Human PR domain containing 2, with ZNF domain (PRDM2), transcript variant 4
CNY 2400.00
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | HUMHOXY1; KMT8; KMT8A; MTB-ZF; RIZ; RIZ1; RIZ2 |
| Vector | pCMV6-XL6 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF sequence for NM_001135610 edited
ATGAATCAGAACACTACTGAGCCTGTGGCGGCCACCGAGACCCTGGCTGAGGTACCCGAA CATGTGCTGCGAGGACTTCCGGAGGAAGTGAGGCTTTTCCCTTCTGCTGTTGACAAGACC CGGATTGGTGTCTGGGCCACTAAACCAATTTTAAAAGGCAAAAAATTTGGGCCATTTGTT GGTGATAAGAAAAAAAGATCTCAGGTTAAGAATAATGTATACATGTGGGAGGTGTATTAC CCAAATTTGGGATGGATGTGCATTGATGCCACTGATCCAGAGAAGGGAAACTGGCTGCGA TATGTGAATTGGGCTTGCTCAGGAGAAGAGCAAAATTTATTCCCACTGGAAATCAACAGA GCCATTTACTATAAAACTTTAAAGCCAATCGCGCCGGGCGAGGAGCTCCTGGTCTGGTAC AATGGGGAAGACAACCCTGAGATAGCAGCTGCGATTGAGGAAGAGCGAGCCAGCGCCCGG AGCAAGCGGAGCTCCCCCAAGAGCCGGAAAGCTACAGCCTCCGCTTGGCGTCCCGATGCT CTCCACCAGCGGCCCCGTACATCACCAGGCAGTATAGGAAGGTCAAAGCTCCAGCTGCAG CCCAGTTCCAGGGACCATTCTTCAAAGAGTAGACACTCTGGCTGCTCCCTGACAGCACCT GAAGTGACCTGGAATCAGTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_001135610 |
| Insert Size | 1200 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001135610.1, NP_001129082.1 |
| RefSeq Size | 2715 bp |
| RefSeq ORF | 681 bp |
| Locus ID | 7799 |
| UniProt ID | Q13029 |
| Protein Families | Druggable Genome |
| Gene Summary | This tumor suppressor gene is a member of a nuclear histone/protein methyltransferase superfamily. It encodes a zinc finger protein that can bind to retinoblastoma protein, estrogen receptor, and the TPA-responsive element (MTE) of the heme-oxygenase-1 gene. Although the functions of this protein have not been fully characterized, it may (1) play a role in transcriptional regulation during neuronal differentiation and pathogenesis of retinoblastoma, (2) act as a transcriptional activator of the heme-oxygenase-1 gene, and (3) be a specific effector of estrogen action. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008] Transcript Variant: This variant (4) has an alternate 5' UTR and lacks two internal coding exons compared to variant 1. The resulting isoform (d) is much shorter and has a distinct C-terminus compared to isoform a. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC227715 | PRDM2 (Myc-DDK-tagged)-Human PR domain containing 2, with ZNF domain (PRDM2), transcript variant 4 |
CNY 2400.00 |
|
| RC227715L3 | Lenti ORF clone of Human PR domain containing 2, with ZNF domain (PRDM2), transcript variant 4, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC227715L4 | Lenti ORF clone of Human PR domain containing 2, with ZNF domain (PRDM2), transcript variant 4, mGFP tagged |
CNY 5890.00 |
|
| RG227715 | PRDM2 (tGFP-tagged) - Human PR domain containing 2, with ZNF domain (PRDM2), transcript variant 4 |
CNY 4370.00 |
