VSTM5 (NM_001144871) Human Untagged Clone
CAT#: SC325594
VSTM5 (untagged)-Human chromosome 11 open reading frame 90 (C11orf90)
CNY 3600.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | C11orf90 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC325594 representing NM_001144871.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAGGCCTCTGCCCAGCGGGAGGAGGAAGACCCGAGGCATCTCCCTAGGACTCTTCGCCCTCTGCCTG GCCGCAGCCCGCTGTCTGCAGAGTCAGGGTGTGTCCCTATACATTCCTCAGGCCACCATCAATGCCACT GTCAAAGAAGACATCCTGCTCTCAGTTGAGTACTCCTGTCATGGAGTGCCCACCATCGAATGGACATAT TCATCCAATTGGGGAACGCAGAAGATCGTGGAGTGGAAACCAGGGACTCAGGCCAACATCTCTCAAAGC CACAAGGACAGAGTCTGCACCTTTGACAACGGCTCCATCCAGCTCTTCAGCGTGGGAGTGAGGGATTCC GGCTACTATGTCATCACCGTGACGGAGCGCCTGGGGAGCAGCCAGTTTGGCACCATCGTGCTGCACGTC TCTGAGATCCTCTATGAAGACCTGCACTTTGTCGCTGTCATCCTTGCTTTTCTCGCTGCTGTGGCCGCA GTATTAATCAGCCTCATGTGGGTTTGTAATAAGTGTGCATATAAATTTCAGAGGAAGAGAAGACACAAA CTCAAAGAAAGCACAACTGAGGAGATTGAGCTGGAAGATGTTGAGTGTTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001144871 |
Insert Size | 603 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001144871.1 |
RefSeq Size | 603 bp |
RefSeq ORF | 603 bp |
Locus ID | 387804 |
UniProt ID | A8MXK1 |
Protein Families | Transmembrane |
MW | 22.4 kDa |
Gene Summary | Cell adhesion-like membrane protein of the central nervous system (CNS) which modulates both the position and complexity of central neurons by altering their membrane morphology and dynamics. Involved in the formation of neuronal dendrites and protrusions including dendritic filopodia. In synaptogenesis, regulates synapse formation by altering dendritic spine morphology and actin distribution. Promotes formation of unstable neuronal spines such as thin and branched types. Regulates neuronal morphogenesis and migration during cortical development in the brain.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227422 | VSTM5 (Myc-DDK-tagged)-Human chromosome 11 open reading frame 90 (C11orf90) |
CNY 3600.00 |
|
RC227422L3 | Lenti ORF clone of Human chromosome 11 open reading frame 90 (C11orf90), Myc-DDK-tagged |
CNY 5890.00 |
|
RC227422L4 | Lenti ORF clone of Human chromosome 11 open reading frame 90 (C11orf90), mGFP tagged |
CNY 5890.00 |
|
RG227422 | VSTM5 (tGFP-tagged) - Human chromosome 11 open reading frame 90 (C11orf90) |
CNY 4370.00 |