DUSP19 (NM_001142314) Human Untagged Clone
CAT#: SC325547
DUSP19 (untagged)-Human dual specificity phosphatase 19 (DUSP19), transcript variant 2
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | DUSP17; LMWDSP3; SKRP1; TS-DSP1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC325547 representing NM_001142314.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTACTCCCTTAACCAGGAAATTAAAGCATTCTCCCGGAATAATCTCAGGAAGCAATGCACCAGGGTG ACAACGCTAACTGGAAAGAAAATTATAGAAACATGGAAAGATGCCAGAATTCATGTTGTGGAAGAAGTA GAGCCGAGCAGTGGGGGTGGTTGTGGTTATGTGCAGGACCTTAGCTCGGACCTGCAAGTTGGCGTTATT AAGCCATGGTTGCTCCTAGGGTCACAAGATGCTGCTCATGATTTGGATACACTGAAAAAGAATAAGGAT GGAGTGGTTCTTGTTCATTGTAATGCAGGCGTTTCCAGGGCTGCTGCAATTGTAATAGGTTTCCTGATG AATTCTGAACAAACCTCATTTACCAGTGCTTTTTCTTTGGTGAAAAATGCAAGACCTTCCATATGTCCA AATTCTGGCTTCATGGAGCAGCTTCGTACATATCAAGAGGGCAAAGAAAGCAATAAGTGTGACAGAATA CAGGAGAACAGTTCATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001142314 |
Insert Size | 501 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001142314.1 |
RefSeq Size | 5226 bp |
RefSeq ORF | 501 bp |
Locus ID | 142679 |
UniProt ID | Q8WTR2 |
Protein Families | Druggable Genome, Phosphatase |
MW | 18.3 kDa |
Gene Summary | Dual-specificity phosphatases (DUSPs) constitute a large heterogeneous subgroup of the type I cysteine-based protein-tyrosine phosphatase superfamily. DUSPs are characterized by their ability to dephosphorylate both tyrosine and serine/threonine residues. They have been implicated as major modulators of critical signaling pathways. DUSP19 contains a variation of the consensus DUSP C-terminal catalytic domain, with the last serine residue replaced by alanine, and lacks the N-terminal CH2 domain found in the MKP (mitogen-activated protein kinase phosphatase) class of DUSPs (see MIM 600714) (summary by Patterson et al., 2009 [PubMed 19228121]).[supplied by OMIM, Dec 2009] Transcript Variant: This variant (2) lacks an alternate in-frame exon in the mid coding region, compared to variant 1, resulting in an isoform (2) that is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The extent of this transcript is supported by transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227061 | DUSP19 (Myc-DDK-tagged)-Human dual specificity phosphatase 19 (DUSP19), transcript variant 2 |
CNY 1200.00 |
|
RC227061L3 | Lenti ORF clone of Human dual specificity phosphatase 19 (DUSP19), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
RC227061L4 | Lenti ORF clone of Human dual specificity phosphatase 19 (DUSP19), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
RG227061 | DUSP19 (tGFP-tagged) - Human dual specificity phosphatase 19 (DUSP19), transcript variant 2 |
CNY 4370.00 |