EEF1E1 (NM_001135650) Human Untagged Clone
CAT#: SC325510
EEF1E1 (untagged)-Human eukaryotic translation elongation factor 1 epsilon 1 (EEF1E1), transcript variant 2
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | AIMP3; P18 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC325510 representing NM_001135650.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCGGCGGCCGCAGAGTTGTCGCTACTGGAGAAGTCCCTGGGACTGAGTAAGGGGAATAAATACAGT GCTCAGGGCGAGCGACAGATTCCAGTTCTTCAGACAAACAATGGTCCAAGTCTAACAGGATTGACTACT ATAGCAGCTCATCTAGTCAAGCAAGCCAACAAAGAATATTTGCTGGGGAGTACTGCAGAAGAAAAAGCA ATCGTTCAGCAGTGGTTAGAATACAGGGTCACTCAAGTAGATGGGCACTCCAGTAAAAATGACATCCAC ACACTGTTGAAGGATCTTAATTCATATCTTGAAGATAAAGTCTACCTTACAGGGTATAACTTTACATTA GCAGATATACTATTGTACTATGGACTTCATCGCTTTATAATAAGGAAGCTGAGGCACACAGAGGTAGGG AACTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001135650 |
Insert Size | 420 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001135650.1 |
RefSeq Size | 609 bp |
RefSeq ORF | 420 bp |
Locus ID | 9521 |
UniProt ID | O43324 |
Protein Families | Druggable Genome |
MW | 15.5 kDa |
Gene Summary | This gene encodes a multifunctional protein that localizes to both the cytoplasm and nucleus. In the cytoplasm, the encoded protein is an auxiliary component of the macromolecular aminoacyl-tRNA synthase complex. However, its mouse homolog has been shown to translocate to the nucleus in response to DNA damage, and it plays a positive role in ATM/ATR-mediated p53 activation. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the neighboring downstream MUTED (muted homolog) gene. An EEF1E1-related pseudogene has been identified on chromosome 2. [provided by RefSeq, Dec 2010] Transcript Variant: This variant (2) includes an alternate 3' terminal exon, compared to variant 1. The resulting protein (isoform 2) has a shorter and distinct C-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227690 | EEF1E1 (Myc-DDK-tagged)-Human eukaryotic translation elongation factor 1 epsilon 1 (EEF1E1), transcript variant 2 |
CNY 1200.00 |
|
RC227690L3 | Lenti ORF clone of Human eukaryotic translation elongation factor 1 epsilon 1 (EEF1E1), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
RC227690L4 | Lenti ORF clone of Human eukaryotic translation elongation factor 1 epsilon 1 (EEF1E1), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
RG227690 | EEF1E1 (tGFP-tagged) - Human eukaryotic translation elongation factor 1 epsilon 1 (EEF1E1), transcript variant 2 |
CNY 4370.00 |