SPOCK2 (NM_001134434) Human Untagged Clone
CAT＃: SC325437
SPOCK2 (untagged)-Human sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 2 (SPOCK2), transcript variant 1
CNY 3990.00
Product images
CNY 1999.00
CNY 2700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | testican-2 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001134434, the custom clone sequence may differ by one or more nucleotides
ATGCGCGCCCCGGGCTGCGGGCGGCTGGTGCTGCCGCTGCTGCTCCTGGCCGCGGCAGCC CTGGCCGAAGGCGACGCCAAGGGGCTCAAGGAGGGCGAGACCCCCGGCAATTTCATGGAG GACGAGCAATGGCTGTCGTCCATCTCGCAGTACAGCGGCAAGATCAAGCACTGGAACCGC TTCCGAGACGTTCCCTCGTCCGACCCACCCAGTACAACGCAGGCCACACCA |
| Restriction Sites | Please inquire |
| ACCN | NM_001134434 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001134434.1, NP_001127906.1 |
| RefSeq Size | 1284 bp |
| RefSeq ORF | 234 bp |
| Locus ID | 9806 |
| UniProt ID | Q92563 |
| Protein Families | Secreted Protein |
| Gene Summary | This gene encodes a protein which binds with glycosaminoglycans to form part of the extracellular matrix. The protein contains thyroglobulin type-1, follistatin-like, and calcium-binding domains, and has glycosaminoglycan attachment sites in the acidic C-terminal region. Three alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Oct 2011] Transcript Variant: This variant (1) shares only the two most-5' exons with variant 2 and has a distinct exon at its 3' end. This results in a protein (isoform 1) with a severely truncated C-terminus that lacks a SPARC_EC domain when compared to isoform 2. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC224995 | SPOCK2 (Myc-DDK-tagged)-Human sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 2 (SPOCK2), transcript variant 1 |
CNY 3990.00 |
|
| RC224995L3 | Lenti-ORF clone of SPOCK2 (Myc-DDK-tagged)-Human sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 2 (SPOCK2), transcript variant 1 |
CNY 5890.00 |
|
| RC224995L4 | Lenti-ORF clone of SPOCK2 (mGFP-tagged)-Human sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 2 (SPOCK2), transcript variant 1 |
CNY 5890.00 |
|
| RG224995 | SPOCK2 (tGFP-tagged) - Human sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 2 (SPOCK2), transcript variant 1 |
CNY 4370.00 |
