GAD65 (GAD2) (NM_001134366) Human Untagged Clone
CAT#: SC325214
GAD2 (untagged)-Human glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa) (GAD2), transcript variant 2
CNY 6544.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | GAD65 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001134366, the custom clone sequence may differ by one or more nucleotides
ATGGCATCTCCGGGCTCTGGCTTTTGGTCTTTCGGGTCGGAAGATGGCTCTGGGGATTCCGAGAATCCCG GCACAGCGCGAGCCTGGTGCCAAGTGGCTCAGAAGTTCACGGGCGGCATCGGAAACAAACTGTGCGCCCT GCTCTACGGAGACGCCGAGAAGCCGGCGGAGAGCGGCGGGAGCCAACCCCCGCGGGCCGCCGCCCGGAAG GCCGCCTGCGCCTGCGACCAGAAGCCCTGCAGCTGCTCCAAAGTGGATGTCAACTACGCGTTTCTCCATG CAACAGACCTGCTGCCGGCGTGTGATGGAGAAAGGCCCACTTTGGCGTTTCTGCAAGATGTTATGAACAT TTTACTTCAGTATGTGGTGAAAAGTTTCGATAGATCAACCAAAGTGATTGATTTCCATTATCCTAATGAG CTTCTCCAAGAATATAATTGGGAATTGGCAGACCAACCACAAAATTTGGAGGAAATTTTGATGCATTGCC AAACAACTCTAAAATATGCAATTAAAACAGGGCATCCTAGATACTTCAATCAACTTTCTACTGGTTTGGA TATGGTTGGATTAGCAGCAGACTGGCTGACATCAACAGCAAATACTAACATGTTCACCTATGAAATTGCT CCAGTATTTGTGCTTTTGGAATATGTCACACTAAAGAAAATGAGAGAAATCATTGGCTGGCCAGGGGGCT CTGGCGATGGGATATTTTCTCCCGGTGGCGCCATATCTAACATGTATGCCATGATGATCGCACGCTTTAA GATGTTCCCAGAAGTCAAGGAGAAAGGAATGGCTGCTCTTCCCAGGCTCATTGCCTTCACGTCTGAACAT AGTCATTTTTCTCTCAAGAAGGGAGCTGCAGCCTTAGGGATTGGAACAGACAGCGTGATTCTGATTAAAT GTGATGAGAGAGGGAAAATGATTCCATCTGATCTTGAAAGAAGGATTCTTGAAGCCAAACAGAAAGGGTT TGTTCCTTTCCTCGTGAGTGCCACAGCTGGAACCACCGTGTACGGAGCATTTGACCCCCTCTTAGCTGTC GCTGACATTTGCAAAAAGTATAAGATCTGGATGCATGTGGATGCAGCTTGGGGTGGGGGATTACTGATGT CCCGAAAACACAAGTGGAAACTGAGTGGCGTGGAGAGGGCCAACTCTGTGACGTGGAATCCACACAAGAT GATGGGAGTCCCTTTGCAGTGCTCTGCTCTCCTGGTTAGAGAAGAGGGATTGATGCAGAATTGCAACCAA ATGCATGCCTCCTACCTCTTTCAGCAAGATAAACATTATGACCTGTCCTATGACACTGGAGACAAGGCCT TACAGTGCGGACGCCACGTTGATGTTTTTAAACTATGGCTGATGTGGAGGGCAAAGGGGACTACCGGGTT TGAAGCGCATGTTGATAAATGTTTGGAGTTGGCAGAGTATTTATACAACATCATAAAAAACCGAGAAGGA TATGAGATGGTGTTTGATGGGAAGCCTCAGCACACAAATGTCTGCTTCTGGTACATTCCTCCAAGCTTGC GTACTCTGGAAGACAATGAAGAGAGAATGAGTCGCCTCTCGAAGGTGGCTCCAGTGATTAAAGCCAGAAT GATGGAGTATGGAACCACAATGGTCAGCTACCAACCCTTGGGAGACAAGGTCAATTTCTTCCGCATGGTC ATCTCAAACCCAGCGGCAACTCACCAAGACATTGACTTCCTGATTGAAGAAATAGAACGCCTTGGACAAG ATTTATAA |
Restriction Sites | Please inquire |
ACCN | NM_001134366 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001134366.1, NP_001127838.1 |
RefSeq Size | 2419 bp |
RefSeq ORF | 1758 bp |
Locus ID | 2572 |
UniProt ID | Q05329 |
Protein Families | Druggable Genome |
Protein Pathways | Alanine, aspartate and glutamate metabolism, beta-Alanine metabolism, Butanoate metabolism, Metabolic pathways, Taurine and hypotaurine metabolism, Type I diabetes mellitus |
Gene Summary | This gene encodes one of several forms of glutamic acid decarboxylase, identified as a major autoantigen in insulin-dependent diabetes. The enzyme encoded is responsible for catalyzing the production of gamma-aminobutyric acid from L-glutamic acid. A pathogenic role for this enzyme has been identified in the human pancreas since it has been identified as an autoantibody and an autoreactive T cell target in insulin-dependent diabetes. This gene may also play a role in the stiff man syndrome. Alternative splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Oct 2008] Transcript Variant: This variant (2) differs in the 3' UTR, compared to variant 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225984 | GAD2 (Myc-DDK-tagged)-Human glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa) (GAD2), transcript variant 2 |
CNY 6536.00 |
|
RC225984L1 | Lenti ORF clone of Human glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa) (GAD2), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
RC225984L2 | Lenti ORF clone of Human glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa) (GAD2), transcript variant 2, mGFP tagged |
CNY 8936.00 |
|
RC225984L3 | Lenti ORF clone of Human glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa) (GAD2), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
RC225984L4 | Lenti ORF clone of Human glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa) (GAD2), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
RG225984 | GAD2 (tGFP-tagged) - Human glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa) (GAD2), transcript variant 2 |
CNY 4370.00 |