TBL1 (TBL1X) (NM_001139467) Human Untagged Clone

CAT#: SC325164

TBL1X (untagged)-Human transducin (beta)-like 1X-linked (TBL1X), transcript variant 3



  "NM_001139467" in other vectors (4)

CNY 7220.00


货期*
5周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-TBL1X Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CHNG8; EBI; SMAP55; TBL1
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001139467, the custom clone sequence may differ by one or more nucleotides
ATGAGCATAACCAGTGACGAGGTGAACTTTCTGGTGTATCGGTATCTCCAGGAGTCAGGT
TTTTCCCACTCGGCTTTCACGTTTGGGATTGAGAGCCACATCAGCCAGTCCAACATCAAT
GGGACGCTAGTGCCACCGGCCGCCCTCATCTCCATTCTCCAGAAGGGCCTGCAGTATGTA
GAGGCCGAGATCAGTATCAACGAGGATGGCACAGTGTTCGACGGCCGCCCCATAGAGTCC
CTGTCACTGATAGACGCCGTGATGCCCGACGTGGTGCAGACGCGGCAGCAGGCATTCCGA
GAGAAGCTCGCTCAGCAGCAAGCCAGTGCGGCGGCGGCGGCGGCTGCGGCCACGGCAGCA
GCGACAGCAGCCACCACGACCTCAGCCGGCGTTTCCCACCAAAATCCATCGAAGAACAGA
GAGGCCACGGTGAATGGGGAAGAGAACAGAGCACATTCAGTCAATAATCACGCGAAGCCA
ATGGAAATAGATGGAGAGGTTGAGATTCCATCCAGCAAAGCCACAGTCCTTCGGGGCCAT
GAGTCTGAGGTGTTCATTTGTGCCTGGAATCCTGTCAGTGATTTGCTAGCCTCCGGATCT
GGAGACTCAACTGCAAGGATATGGAACCTGAATGAGAATAGCAACGGGGGCTCCACCCAG
CTCGTGTTGAGGCACTGTATACGAGAGGGGGGCCATGACGTCCCGAGTAACAAAGACGTC
ACCTCACTGGACTGGAATACCAATGGAACACTCTTGGCTACGGGTTCATATGACGGTTTT
GCAAGAATATGGACGGAAGATGGTAACCTGGCCAGCACCTTAGGCCAACATAAAGGCCCC
ATCTTTGCCTTGAAATGGAACCGAAAGGGGAATTACATTTTGAGTGCTGGTGTAGACAAA
ACAACAATAATTTGGGATGCCCACACAGGAGAAGCCAAACAGCAGTTTCCTTTTCATTCA
GCCCCTGCCCTTGATGTGGACTGGCAGAACAACACGACCTTTGCCTCCTGTAGCACAGAC
ATGTGTATCCATGTGTGCAGGCTCGGCTGTGACCGCCCAGTCAAAACCTTCCAGGGACAC
ACAAACGAGGTCAACGCCATCAAATGGGATCCGTCTGGAATGTTGCTGGCATCCTGCTCG
GATGACATGACATTGAAGATCTGGAGCATGAAACAGGAGGTGTGCATCCATGATCTTCAG
GCTCACAATAAAGAGATCTACACCATCAAGTGGAGCCCCACTGGGCCCGCCACCAGCAAC
CCAAACTCCAACATCATGTTGGCAAGTGCTTCGTTTGATTCTACGGTGCGACTGTGGGAC
ATAGAACGAGGCGTCTGCACCCACACGCTCACGAAGCATCAGGAGCCTGTCTATAGCGTA
GCTTTCAGCCCTGATGGGAAGTACTTGGCCAGTGGATCCTTCGACAAGTGCGTCCATATC
TGGAATACTCAGAGTGGAAATCTTGTCCACAGCTACCGAGGCACTGGCGGCATCTTCGAG
GTGTGCTGGAACGCCCGAGGAGACAAAGTGGGTGCCAGCGCGTCCGACGGCTCTGTGTGT
GTTTTGGATCTGCGGAAG
Restriction Sites Please inquire     
ACCN NM_001139467
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001139467.1, NP_001132939.1
RefSeq Size 5451 bp
RefSeq ORF 1581 bp
Locus ID 6907
UniProt ID O60907
Protein Families Transcription Factors
Protein Pathways Wnt signaling pathway
Gene Summary The protein encoded by this gene has sequence similarity with members of the WD40 repeat-containing protein family. The WD40 group is a large family of proteins, which appear to have a regulatory function. It is believed that the WD40 repeats mediate protein-protein interactions and members of the family are involved in signal transduction, RNA processing, gene regulation, vesicular trafficking, cytoskeletal assembly and may play a role in the control of cytotypic differentiation. This encoded protein is found as a subunit in corepressor SMRT (silencing mediator for retinoid and thyroid receptors) complex along with histone deacetylase 3 protein. This gene is located adjacent to the ocular albinism gene and it is thought to be involved in the pathogenesis of the ocular albinism with late-onset sensorineural deafness phenotype. Four transcript variants encoding two different isoforms have been found for this gene. This gene is highly similar to the Y chromosome TBL1Y gene. [provided by RefSeq, Nov 2008]
Transcript Variant: This variant (3) differs in the 5' UTR and lacks the alternate first coding exon compared to variant 1. The resulting isoform (b) is shorter at the N-terminus compared to isoform a. Variants 3 and 4 both encode isoform b. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...