SIRT1 (NM_001142498) Human Untagged Clone

CAT#: SC325096

SIRT1 (untagged)-Human sirtuin 1 (SIRT1), transcript variant 2



  "NM_001142498" in other vectors (6)

CNY 5488.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (3)
SIRT1 mouse monoclonal antibody,clone OTI5B2
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms SIR2; SIR2alpha; SIR2L1
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_001142498 edited
ATGTTTGATATTGAATATTTCAGAAAAGATCCAAGACCATTCTTCAAGTTTGCAAAGGAA
ATATATCCTGGACAATTCCAGCCATCTCTCTGTCACAAATTCATAGCCTTGTCAGATAAG
GAAGGAAAACTACTTCGCAACTATACCCAGAACATAGACACGCTGGAACAGGTTGCGGGA
ATCCAAAGGATAATTCAGTGTCATGGTTCCTTTGCAACAGCATCTTGCCTGATTTGTAAA
TACAAAGTTGACTGTGAAGCTGTACGAGGAGATATTTTTAATCAGGTAGTTCCTCGATGT
CCTAGGTGCCCAGCTGATGAACCGCTTGCTATCATGAAACCAGAGATTGTGTTTTTTGGT
GAAAATTTACCAGAACAGTTTCATAGAGCCATGAAGTATGACAAAGATGAAGTTGACCTC
CTCATTGTTATTGGGTCTTCCCTCAAAGTAAGACCAGTAGCACTAATTCCAAGTTCCATA
CCCCATGAAGTGCCTCAGATATTAATTAATAGAGAACCTTTGCCTCATCTGCATTTTGAT
GTAGAGCTTCTTGGAGACTGTGATGTCATAATTAATGAATTGTGTCATAGGTTAGGT:GG
TGAATATGCCAAACTTTGCTGTAACCCTGTAAAGCTTTCAGAAATTACTGAAAAACCTCC
ACGAACACAAAAAGAATTGGCTTATTTGTCAGAGTTGCCACCCACACCTCTTCATGTTTC
AGAAGACTCAAGTTCACCAGAAAGAACTTCACCACCAGATTCTTCAGTGATTGTCACACT
TTTAGACCAAGCAGCTAAGAGTAATGATGATTTAGATGTGTCTGAATCAAAAGGTTGTAT
GGAAGAAAAACCACAGGAAGTACAAACTTCTAGGAATGTTGAAAGTATTGCTGAACAGAT
GGAAAATCCGGATTTGAAGAATGTTGGTTCTAGTACTGGGGAGAAAAATGAAAGAACTTC
AGTGGCTGGAACAGTGAGAAAATGCTGGCCTAATAGAGTGGCAAAGGAGCAGATTAGTAG
GCGGCTTGATGGTAATCAGTATCTGTTTTTGCCACCAAATCGTTACATTTTCCATGGCGC
TGAGGTATATTCAGACTCTGAAGATGACGTCTTATCCTCTAGTTCTTGTGGCAGTAACAG
TGATAGTGGGACATGCCAGAGTCCAAGTTTAGAAGAACCCATGGAGGATGAAAGTGAAAT
TGAAGAATTCTACAATGGCTTAGAAGATGAGCCTGATGTTCCAGAGAGAGCTGGAGGAGC
TGGATTTGGGACTGATGGAGATGATCAAGAGGCAATTAATGAAGCTATATCTGTGAAACA
GGAAGTAACAGACATGAACTATCCATCAAACAAATCATAG
Restriction Sites Please inquire     
ACCN NM_001142498
Insert Size 3600 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001142498.1, NP_001135970.1
RefSeq Size 3604 bp
RefSeq ORF 1359 bp
Locus ID 23411
UniProt ID Q96EB6
Protein Families Druggable Genome, Stem cell - Pluripotency, Transcription Factors
Gene Summary This gene encodes a member of the sirtuin family of proteins, homologs to the yeast Sir2 protein. Members of the sirtuin family are characterized by a sirtuin core domain and grouped into four classes. The functions of human sirtuins have not yet been determined; however, yeast sirtuin proteins are known to regulate epigenetic gene silencing and suppress recombination of rDNA. Studies suggest that the human sirtuins may function as intracellular regulatory proteins with mono-ADP-ribosyltransferase activity. The protein encoded by this gene is included in class I of the sirtuin family. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2008]
Transcript Variant: This variant (2) contains an alternate in-frame exon in the 5' coding region and uses a downstream start codon, compared to variant 1. Isoform b has a shorter N-terminus, compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...