MEF2A (NM_001130928) Human Untagged Clone

CAT#: SC325086

MEF2A (untagged)-Human myocyte enhancer factor 2A (MEF2A), transcript variant 4



  "NM_001130928" in other vectors (4)

CNY 7220.00


货期*
5周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


MEF2A rabbit polyclonal antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ADCAD1; mef2; RSRFC4; RSRFC9
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001130928, the custom clone sequence may differ by one or more nucleotides
ATGGGGCGGAAGAAAATACAAATCACACGCATAATGGATGAAAGGAACCGACAGACTTTA
AGAAAGAAAGGCCTTAATGGTTGTGAGAGCCCTGATGCTGACGATTACTTTGAGCACAGT
CCACTCTCGGAGGACAGATTCAGCAAACTAAATGAAGATAGTGATTTTATTTTCAAACGA
GGCCCTCCTGGTCTGCCACCTCAGAACTTTTCAATGTCTGTCACAGTTCCAGTGACCAGC
CCCAATGCTTTGTCCTACACTAACCCAGGGAGTTCACTGGTGTCCCCATCTTTGGCAGCC
AGCTCAACGTTAACAGATTCAAGCATGCTCTCTCCACCTCAAACCACATTACATAGAAAT
GTGTCTCCTGGAGCTCCTCAGAGACCACCAAGTACTGGCAATGCAGGTGGGATGTTGAGC
ACTACAGACCTCACAGTGCCAAATGGAGCTGGAAGCAGTCCAGTGGGGAATGGATTTGTA
AACTCAAGAGCTTCTCCAAATTTGATTGGAGCTACTGGTGCAAATAGCTTAGGCAAAGTC
ATGCCTACAAAGTCTCCCCCTCCACCAGGTGGTGGTAATCTTGGAATGAACAGTAGGAAA
CCAGATCTTCGAGTTGTCATCCCCCCTTCAAGCAAGGGCATGATGCCTCCACTAAATACC
CAAAGGATCAGTAGTTCTCAAGCCACTCAACCTCTTGCTACCCCAGTCGTGTCTGTGACA
ACCCCAAGCTTGCCTCCGCAAGGACTTGTGTACTCAGCAATGCCGACTGCCTACAACACT
GATTATTCACTGACCAGCGCTGACCTGTCAGCCCTTCAAGGCTTCAACTCGCCAGGAATG
CTGTCGCTGGGACAGGTGTCGGCCTGGCAGCAGCACCACCTAGGACAAGCAGCCCTCAGC
TCTCTTGTTGCTGGAGGGCAGTTATCTCAGGGTTCCAATTTATCCATTAATACCAACCAA
AACATCAGCATCAAGTCCGAACCGATTTCACCTCCTCGGGATCGTATGACCCCATCGGGC
TTCCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCCGCCGCCACCACCGCAGCCCCAG
CCACAACCCCCGCAGCCCCAGCCCCGACAGGAAATGGGGCGCTCCCCTGTGGACAGTCTG
AGCAGCTCTAGTAGCTCCTATGATGGCAGTGATCGGGAGGATCCACGGGGCGACTTCCAT
TCTCCAATTGTGCTTGGCCGACCCCCAAACACTGAGGACAGAGAAAGCCCTTCTGTAAAG
CGAATGAGGATGGACGCGTGGGTGACC
Restriction Sites Please inquire     
ACCN NM_001130928
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001130928.1, NP_001124400.1
RefSeq Size 5100 bp
RefSeq ORF 1290 bp
Locus ID 4205
UniProt ID Q02078
Protein Families Transcription Factors
Gene Summary The protein encoded by this gene is a DNA-binding transcription factor that activates many muscle-specific, growth factor-induced, and stress-induced genes. The encoded protein can act as a homodimer or as a heterodimer and is involved in several cellular processes, including muscle development, neuronal differentiation, cell growth control, and apoptosis. Defects in this gene could be a cause of autosomal dominant coronary artery disease 1 with myocardial infarction (ADCAD1). Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jan 2010]
Transcript Variant: This variant (4) lacks multiple, in-frame coding exons, compared to transcript variant 6. These differences result in a shorter isoform (4), compared to isoform 5. The 5' UTR of this transcript variant is undefined. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...