HMBOX1 (NM_001135726) Human Untagged Clone
CAT#: SC325078
HMBOX1 (untagged)-Human homeobox containing 1 (HMBOX1), transcript variant 2
CNY 3656.00
CNY 7220.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | HNF1LA; HOT1; PBHNF; TAH1 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF sequence for NM_001135726 edited
ATGCTTAGTTCCTTTCCAGTGGTTTTGCTGGAAACCATGTCTCATTATACAGATGAACCC AGATTTACCATAGAGCAGATAGATCTGCTTCAGCGACTTCGGCGTACTGGAATGACTAAA CATGAAATTCTCCATGCCTTGGAAACTTTGGACCGTCTTGATCAAGAGCATAGTGACAAG TTTGGAAGAAGGTCCAGCTATGGAGGAAGTTCATATGGGAATAGTACTAACAATGTCCCA GCATCTTCCTCTACAGCTACAGCTTCCACACAGACGCAGCATTCGGGAATGTCCCCGTCA CCTAGCAACAGTTATGATACTTCCCCACAGCCTTGCACTACCAATCAAAATGGGAGGGAG AATAATGAGCGATTATCTACATCCAATGGAAAGATGTCACCAACTCGCTACCATGCAAAC AGCATGGGTCAGAGGTCATACAGTTTTGAAGCCTCAGAAGAGGACCTAGATGTAGATGAT AAAGTGGAAGAATTAATGAGGAGGGACAGCAGTGTGATAAAAGAGGAAATCAAAGCCTTT CTTGCCAATCGGAGGATTTCCCAAGCAGTTGTTGCACAGGTAACAGGTATCAGTCAGAGC CGGATCTCTCATTGGCTGTTGCAGCAGGGATCAGACCTGAGTGAACAGAAGAAAAGAGCA TTTTACCGATGGTATCAACTTGAGAAGACAAACCCTGGCGCTACACTAAGTATGAGACCA GCCCCCATTCCAATAGAGGACCCTGAATGGAGACAAACGCCTCCCCCAGTCTCTGCCACA TCTGGTACTTTCCGACTGCGACGAGGGAGTCGATTTACCTGGAGAAAGGAGTGCCTGGCT GTTATGGAAAGTTACTTCAATGAGAATCAATACCCAGATGAAGCAAAGAGGGAAGAAATT GCAAACGCTTGCAATGCAGTTATACAGAAGCCAGGCAAAAAGCTGTCAGATCTGGAAAGA GTTACCTCCCTGAAAGTATATAATTGGTTTGCTAACAGAAGGAAGGAGATCAAGAGGAGA GCCAATATTGAAGCAGCAATCCTGGAGAGTCATGGGATAGATGTGCAGAGTCCAGGAGGC CACTCAAACAGTGATGATGTCGACGGGAATGACTACTCTGAGCAGGATGACAGTACGAGC CATAGTGACCACCAAGACCCCATCTCATTAGCTGTGGAAATGGCAGCAGTCAACCACACT ATCTTGGCATTGGCCCGACAAGGAGCCAACGAAATCAAGACAGAGGCCCTGGATGATGAC TGA |
| Restriction Sites | NotI-NotI |
| ACCN | NM_001135726 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001135726.1. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001135726.1, NP_001129198.1 |
| RefSeq Size | 3175 bp |
| RefSeq ORF | 1263 bp |
| Locus ID | 79618 |
| UniProt ID | Q6NT76 |
| Protein Families | Transcription Factors |
| Gene Summary | Binds directly to 5'-TTAGGG-3' repeats in telomeric DNA (PubMed:23813958, PubMed:23685356). Associates with the telomerase complex at sites of active telomere processing and positively regulates telomere elongation (PubMed:23685356). Important for TERT binding to chromatin, indicating a role in recruitment of the telomerase complex to telomeres (By similarity). Also plays a role in the alternative lengthening of telomeres (ALT) pathway in telomerase-negative cells where it promotes formation and/or maintenance of ALT-associated promyelocytic leukemia bodies (APBs) (PubMed:23813958). Enhances formation of telomere C-circles in ALT cells, suggesting a possible role in telomere recombination (PubMed:23813958). Might also be involved in the DNA damage response at telomeres (PubMed:23813958).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1, 2, and 3 all encode the same isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC227861 | HMBOX1 (Myc-DDK-tagged)-Human homeobox containing 1 (HMBOX1), transcript variant 2 |
CNY 3656.00 |
|
| RC227861L3 | Lenti ORF clone of Human homeobox containing 1 (HMBOX1), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC227861L4 | Lenti ORF clone of Human homeobox containing 1 (HMBOX1), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
| RG227861 | HMBOX1 (tGFP-tagged) - Human homeobox containing 1 (HMBOX1), transcript variant 2 |
CNY 4370.00 |
