LXR alpha (NR1H3) (NM_001130102) Human Untagged Clone
CAT#: SC325053
NR1H3 (untagged)-Human nuclear receptor subfamily 1, group H, member 3 (NR1H3), transcript variant 3
CNY 7220.00
Product images

CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | LXR-a; LXRA; RLD-1 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001130102, the custom clone sequence may differ by one or more nucleotides
ATGCCCCACTCTGCTGGGGGTACTGCAGGGGTGGGGCTGGAGGCTGCAGAGCCCACAGCC CTGCTCACCAGGGCAGAGCCCCCTTCAGAACCCACAGAGATCCGTCCACAAAAGCGGAAA AAGGGGCCAGCCCCCAAAATGCTGGGGAACGAGCTATGCAGCGTGTGTGGGGACAAGGCC TCGGGCTTCCACTACAATGTTCTGAGCTGCGAGGGCTGCAAGGGATTCTTCCGCCGCAGC GTCATCAAGGGAGCGCACTACATCTGCCACAGTGGCGGCCACTGCCCCATGGACACCTAC ATGCGTCGCAAGTGCCAGGAGTGTCGGCTTCGCAAATGCCGTCAGGCTGGCATGCGGGAG GAGTGTGTCCTGTCAGAAGAACAGATCCGCCTGAAGAAACTGAAGCGGCAAGAGGAGGAA CAGGCTCATGCCACATCCTTGCCCCCCAGGGCTTCCTCACCCCCCCAAATCCTGCCCCAG CTCAGCCCGGAACAACTGGGCATGATCGAGAAGCTCGTCGCTGCCCAGCAACAGTGTAAC CGGCGCTCCTTTTCTGACCGGCTTCGAGTCACGCCTTGGCCCATGGCACCAGATCCCCAT AGCCGGGAGGCCCGTCAGCAGCGCTTTGCCCACTTCACTGAGCTGGCCATCGTCTCTGTG CAGGAGATAGTTGACTTTGCTAAACAGCTACCCGGCTTCCTGCAGCTCAGCCGGGAGGAC CAGATTGCCCTGCTGAAGACCTCTGCGATCGAGGTGATGCTTCTGGAGACATCTCGGAGG TACAACCCTGGGAGTGAGAGTATCACCTTCCTCAAGGATTTCAGTTATAACCGGGAAGAC TTTGCCAAAGCAGGGCTGCAAGTGGAATTCATCAACCCCATCTTCGAGTTCTCCAGGGCC ATGAATGAGCTGCAACTCAATGATGCCGAGTTTGCCTTGCTCATTGCTATCAGCATCTTC TCTGCAGACCGGCCCAACGTGCAGGACCAGCTCCAGGTAGAGAGGCTGCAGCACACATAT GTGGAAGCCCTGCATGCCTACGTCTCCATCCACCATCCCCATGACCGACTGATGTTCCCA CGGATGCTAATGAAACTGGTGAGCCTCCGGACCCTGAGCAGCGTCCACTCAGAGCAAGTG TTTGCACTGCGTCTGCAGGACAAAAAGCTCCCACCGCTGCTCTCTGAGATCTGGGATGTG CACGAA |
Restriction Sites | Please inquire |
ACCN | NM_001130102 |
Insert Size | 1748 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001130102.1, NP_001123574.1 |
RefSeq Size | 1748 bp |
RefSeq ORF | 1209 bp |
Locus ID | 10062 |
UniProt ID | Q13133 |
Protein Families | Druggable Genome, Nuclear Hormone Receptor, Transcription Factors |
Protein Pathways | PPAR signaling pathway |
Gene Summary | The protein encoded by this gene belongs to the NR1 subfamily of the nuclear receptor superfamily. The NR1 family members are key regulators of macrophage function, controlling transcriptional programs involved in lipid homeostasis and inflammation. This protein is highly expressed in visceral organs, including liver, kidney and intestine. It forms a heterodimer with retinoid X receptor (RXR), and regulates expression of target genes containing retinoid response elements. Studies in mice lacking this gene suggest that it may play an important role in the regulation of cholesterol homeostasis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011] Transcript Variant: This variant (3) contains an alternate 5' terminal exon and lacks another exon compared to variant 1. This results in translation initiation from an in-frame downstream AUG, and an isoform (3) with a shorter N-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225628 | NR1H3 (Myc-DDK-tagged)-Human nuclear receptor subfamily 1, group H, member 3 (NR1H3), transcript variant 3 |
CNY 3990.00 |
|
RC225628L3 | Lenti-ORF clone of NR1H3 (Myc-DDK-tagged)-Human nuclear receptor subfamily 1, group H, member 3 (NR1H3), transcript variant 3 |
CNY 5890.00 |
|
RC225628L4 | Lenti-ORF clone of NR1H3 (mGFP-tagged)-Human nuclear receptor subfamily 1, group H, member 3 (NR1H3), transcript variant 3 |
CNY 5890.00 |
|
RG225628 | NR1H3 (tGFP-tagged) - Human nuclear receptor subfamily 1, group H, member 3 (NR1H3), transcript variant 3 |
CNY 4370.00 |
其它LXR alpha产品