FAIM3 (FCMR) (NM_001142472) Human Untagged Clone

CAT#: SC325033

FAIM3 (untagged)-Human Fas apoptotic inhibitory molecule 3 (FAIM3), transcript variant 2



  "NM_001142472" in other vectors (6)

CNY 7220.00


货期*
2周

规格
    • 10 ug

Product images

推荐一起购买 (4)
FAIM3 mouse monoclonal antibody, clone OTI1E6 (formerly 1E6)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms Fas apoptotic inhibitory molecule 3; OTTHUMP00000034619; regulator of Fas-induced apoptosis; TOSO
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001142472, the custom clone sequence may differ by one or more nucleotides


ATGGACTTCTGGCTTTGGCCACTTTACTTCCTGCCAGTATCGGGGGCCCTGAGGATCCTCCCAGAAGTAA
AGGTAGAGGGGGAGCTGGGCGGATCAGTTACCATCAAGTGCCCACTTCCTGAAATGCATGTGAGGATATA
TCTGTGCCGGGAGATGGCTGGATCTGGAACATGTGGTACCGTGGTATCCACCACCAACTTCATCAAGGCA
GAATACAAGGGCCGAGTTACTCTGAAGCAATACCCACGCAAGAATCTGTTCCTAGTGGAGGTAACACAGC
TGACAGAAAGTGACAGCGGAGTCTATGCCTGCGGAGCGGGCATGAACACAGACCGGGGAAAGACCCAGAA
AGTCACCCTGAATGTCCACAGTGAATACGAGCCATCATGGGAAGAGCAGCCAATGCCTGAGACTCCAAAA
TGGTTTCATCTGCCCTATTTGTTCCAGATGCCTGCATATGCCAGTTCTTCCAAATTCGTAACCAGAGTTA
CCACACCAGCTCAAAGGGGCAAGGTCCCTCCAGTTCACCACTCCTCCCCCACCACCCAAATCACCCACCG
CCCTCGAGTGTCCAGAGCATCTTCAGTAGCAGGTGACAAGCCCCGAACCTTCCTGCCATCCACTACAGCC
TCAAAAATCTCAGCTCTGGAGGGGCTGCTCAAGCCCCAGACGCCCAGCTACAACCACCACACCAGGCTGC
ACAGGCAGAGAGCACTGGACTATGGCTCACAGTCTGGGAGGGAAGGCCAAGGATTTCACATCCTGATCCC
GACCATCCTGGGCCTTTTCCTGCTGGCACTTCTGGGGCTGGTGGTGAAAAGGGCCGTTGAAAGGAGGAAA
GCCCTCTCCAGGCGGGCCCGCCGACTGGCCGTGAGGATGCGCGCCCTGGAGAGCTCCCAGAGGCCCCGCG
GGTCGCCGCGACCGCGCTCCCAAAACAACATCTACAGCGCCTGCCCGCGGCGCGCTCGTGGAGCGGACGC
TGCAGGCACAGGGGAGGCCCCCGTTCCCGGCCCCGGAGCGCCGTTGCCCCCCGCCCCGCTGCAGGTGTCT
GAATCTCCCTGGCTCCATGCCCCATCTCTGAAGACCAGCTGTGAATACGTGAGCCTCTACCACCAGCCTG
CCGCCATGATGGAGGACAGTGATTCAGATGACTACATCAATGTTCCTGCCTGA


Restriction Sites Please inquire     
ACCN NM_001142472
Insert Size 1900 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001142472.1, NP_001135944.1
RefSeq Size 3067 bp
RefSeq ORF 1173 bp
Locus ID 9214
Protein Families Druggable Genome, Transmembrane
Gene Summary Fc receptors specifically bind to the Fc region of immunoglobulins (Igs) to mediate the unique functions of each Ig class. FAIM3 encodes an Fc receptor for IgM (see MIM 147020) (Kubagawa et al., 2009 [PubMed 19858324]; Shima et al., 2010 [PubMed 20042454]).[supplied by OMIM, Jul 2010]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 encode the same isoform (a).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...