PTPN18 (NM_001142370) Human Untagged Clone

CAT#: SC324985

PTPN18 (untagged)-Human protein tyrosine phosphatase, non-receptor type 18 (brain-derived) (PTPN18), transcript variant 2



  "NM_001142370" in other vectors (6)

CNY 7220.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BDP1; PTP-HSCF
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC324985 representing NM_001142370.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAGCCGCAGCCTGGACTCGGCGCGGAGCTTCCTGGAGCGGCTGGAAGCGCGGGGCGGCCGGGAGGGG
GCAGTCCTCGCCGGCGAGTTCAGCAAAAGGTGTGAGCGGTACTGGGCCCAGGAGCAGGAGCCACTGCAG
ACTGGGCTTTTCTGCATCACTCTGATAAAGGAGAAGTGGCTGAATGAGGACATCATGCTCAGGACCCTC
AAGGTCACATTCCAGAAGGAGTCCCGTTCTGTGTACCAGCTACAGTATATGTCCTGGCCAGACCGTGGG
GTCCCCAGCAGTCCTGACCACATGCTCGCCATGGTGGAGGAAGCCCGTCGCCTCCAGGGATCTGGCCCT
GAACCCCTCTGTGTCCACTGCAGTGCGGGTTGTGGGCGAACAGGCGTCCTGTGCACCGTGGATTATGTG
AGGCAGCTGCTCCTGACCCAGATGATCCCACCTGACTTCAGTCTCTTTGATGTGGTCCTTAAGATGAGG
AAGCAGCGGCCTGCGGCCGTGCAGACAGAGGAGCAGTACAGGTTCCTGTACCACACGGTGGCTCAGATG
TTCTGCTCCACACTCCAGAATGCCAGCCCCCACTACCAGAACATCAAAGAGAATTGTGCCCCACTCTAC
GACGATGCCCTCTTCCTCCGGACTCCCCAGGCACTTCTCGCCATACCCCGCCCACCAGGAGGGGTCCTC
AGGAGCATCTCTGTGCCCGGGTCCCCGGGCCACGCCATGGCTGACACCTACGCGGTGGTGCAGAAGCGC
GGGGCTCCAGCGGGCGCCGGGAGTGGGACGCAGACGGGGACGGGGACGGGGACGGGGGCGCGCAGCGCG
GAGGAGGCGCCGCTCTACAGCAAGGTGACGCCGCGCGCCCAGCGACCCGGGGCGCACGCGGAGGACGCG
AGGGGGACGCTGCCTGGCCGCGTTCCTGCTGACCAAAGTCCTGCCGGATCTGGCGCCTACGAGGACGTG
GCGGGTGGAGCTCAGACCGGTGGGCTAGGTTTCAACCTGCGCATTGGGAGGCCGAAGGGTCCCCGGGAC
CCGCCTGCTGAGTGGACCCGGGTGTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001142370
Insert Size 1062 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001142370.1
RefSeq Size 3365 bp
RefSeq ORF 1062 bp
Locus ID 26469
UniProt ID Q99952
Protein Families Druggable Genome, Phosphatase
MW 38.5 kDa
Gene Summary The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, the mitotic cycle, and oncogenic transformation. This PTP contains a PEST motif, which often serves as a protein-protein interaction domain, and may be related to protein intracellular half-live. This protein can differentially dephosphorylate autophosphorylated tyrosine kinases that are overexpressed in tumor tissues, and it appears to regulate HER2, a member of the epidermal growth factor receptor family of receptor tyrosine kinases. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2008]
Transcript Variant: This variant (2) lacks four internal exons in the 5' coding region that results in the loss of an in-frame segment, compared to variant 1. The encoded isoform (2) is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...