PTPN18 (NM_001142370) Human Untagged Clone
CAT#: SC324985
PTPN18 (untagged)-Human protein tyrosine phosphatase, non-receptor type 18 (brain-derived) (PTPN18), transcript variant 2
CNY 7220.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | BDP1; PTP-HSCF |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC324985 representing NM_001142370.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAGCCGCAGCCTGGACTCGGCGCGGAGCTTCCTGGAGCGGCTGGAAGCGCGGGGCGGCCGGGAGGGG GCAGTCCTCGCCGGCGAGTTCAGCAAAAGGTGTGAGCGGTACTGGGCCCAGGAGCAGGAGCCACTGCAG ACTGGGCTTTTCTGCATCACTCTGATAAAGGAGAAGTGGCTGAATGAGGACATCATGCTCAGGACCCTC AAGGTCACATTCCAGAAGGAGTCCCGTTCTGTGTACCAGCTACAGTATATGTCCTGGCCAGACCGTGGG GTCCCCAGCAGTCCTGACCACATGCTCGCCATGGTGGAGGAAGCCCGTCGCCTCCAGGGATCTGGCCCT GAACCCCTCTGTGTCCACTGCAGTGCGGGTTGTGGGCGAACAGGCGTCCTGTGCACCGTGGATTATGTG AGGCAGCTGCTCCTGACCCAGATGATCCCACCTGACTTCAGTCTCTTTGATGTGGTCCTTAAGATGAGG AAGCAGCGGCCTGCGGCCGTGCAGACAGAGGAGCAGTACAGGTTCCTGTACCACACGGTGGCTCAGATG TTCTGCTCCACACTCCAGAATGCCAGCCCCCACTACCAGAACATCAAAGAGAATTGTGCCCCACTCTAC GACGATGCCCTCTTCCTCCGGACTCCCCAGGCACTTCTCGCCATACCCCGCCCACCAGGAGGGGTCCTC AGGAGCATCTCTGTGCCCGGGTCCCCGGGCCACGCCATGGCTGACACCTACGCGGTGGTGCAGAAGCGC GGGGCTCCAGCGGGCGCCGGGAGTGGGACGCAGACGGGGACGGGGACGGGGACGGGGGCGCGCAGCGCG GAGGAGGCGCCGCTCTACAGCAAGGTGACGCCGCGCGCCCAGCGACCCGGGGCGCACGCGGAGGACGCG AGGGGGACGCTGCCTGGCCGCGTTCCTGCTGACCAAAGTCCTGCCGGATCTGGCGCCTACGAGGACGTG GCGGGTGGAGCTCAGACCGGTGGGCTAGGTTTCAACCTGCGCATTGGGAGGCCGAAGGGTCCCCGGGAC CCGCCTGCTGAGTGGACCCGGGTGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001142370 |
Insert Size | 1062 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001142370.1 |
RefSeq Size | 3365 bp |
RefSeq ORF | 1062 bp |
Locus ID | 26469 |
UniProt ID | Q99952 |
Protein Families | Druggable Genome, Phosphatase |
MW | 38.5 kDa |
Gene Summary | The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, the mitotic cycle, and oncogenic transformation. This PTP contains a PEST motif, which often serves as a protein-protein interaction domain, and may be related to protein intracellular half-live. This protein can differentially dephosphorylate autophosphorylated tyrosine kinases that are overexpressed in tumor tissues, and it appears to regulate HER2, a member of the epidermal growth factor receptor family of receptor tyrosine kinases. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2008] Transcript Variant: This variant (2) lacks four internal exons in the 5' coding region that results in the loss of an in-frame segment, compared to variant 1. The encoded isoform (2) is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC226517 | PTPN18 (Myc-DDK-tagged)-Human protein tyrosine phosphatase, non-receptor type 18 (brain-derived) (PTPN18), transcript variant 2 |
CNY 3656.00 |
|
RC226517L1 | Lenti ORF clone of Human protein tyrosine phosphatase, non-receptor type 18 (brain-derived) (PTPN18), transcript variant 2, Myc-DDK-tagged |
CNY 6056.00 |
|
RC226517L2 | Lenti ORF clone of Human protein tyrosine phosphatase, non-receptor type 18 (brain-derived) (PTPN18), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
RC226517L3 | Lenti ORF clone of Human protein tyrosine phosphatase, non-receptor type 18 (brain-derived) (PTPN18), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
RC226517L4 | Lenti ORF clone of Human protein tyrosine phosphatase, non-receptor type 18 (brain-derived) (PTPN18), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
RG226517 | PTPN18 (tGFP-tagged) - Human protein tyrosine phosphatase, non-receptor type 18 (brain-derived) (PTPN18), transcript variant 2 |
CNY 4370.00 |