Syntaxin 16 (STX16) (NM_001134772) Human Untagged Clone
CAT#: SC324941
STX16 (untagged)-Human syntaxin 16 (STX16), transcript variant 3
CNY 6270.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | SYN16 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001134772, the custom clone sequence may differ by one or more nucleotides
ATGGCCACCAGGCGTTTAACCGACGCTTTCTTGTTGTTGCGGAATAATTCCATCCAAAAC CGGCAGCTGTTAGCCGAGCAAGTGAGTAGTCACATCACCTCCAGCCCTCTGCATTCACGT AGCATTGCTGCGCTTGCTGATGACCGTATGGCACTGGTGTCAGGCATCAGCTTAGATCCA GAAGCAGCGATTGGTGTGACAAAACGGCCACCTCCTAAGTGGGTGGATGGAGTGGATGAA ATTCAGTATGATGTTGGCCGGATTAAGCAGAAGATGAAAGAATTGGCCAGCCTTCATGAC AAGCATTTAAACAGACCCACCCTGGATGACAGCAGCGAAGAGGAACATGCCATTGAGATA ACTACCCAAGAGATCACTCAGCTCTTCCACAGGTGCCAGCGTGCCGTGCAGGCCCTGCCG AGCCGGGCCCGGGCCTGCTCCGAGCAGGAGGGGCGGCTGCTTGGGAACGTGGTGGCCTCG CTGGCGCAGGCCCTGCAGGAACTCTCCACCAGCTTCCGGCACGCACAGTCAGGCTACCTC AAACGCATGAAGAATCGAGAGGAAAGATCCCAGCATTTTTTCGACACATCAGTACCACTA ATGGATGATGGAGACGATAACACTCTTTACCATCGGGGTTTTACAGAGGACCAGTTAGTT CTGGTGGAGCAGAACACACTGATGGTGGAAGAGCGGGAACGAGAGATTCGCCAGATTGTA CAGTCCATTTCTGACCTGAATGAAATATTCAGGGACTTAGGGGCGATGATTGTAGAACAG GGTACAGTCCTTGACAGAATTGACTATAACGTTGAACAGTCCTGTATCAAAACTGAAGAT GGTTTGAAACAGCTTCACAAGGCAGAACAGTATCAAAAGAAGAATCGGAAGATGCTTGTG ATTTTAATATTATTTGTCATCATCATTGTGCTCATTGTTGTCCTCGTTGGCGTGAAGTCT CGA |
Restriction Sites | Please inquire |
ACCN | NM_001134772 |
Insert Size | 4966 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001134772.1, NP_001128244.1 |
RefSeq Size | 4966 bp |
RefSeq ORF | 966 bp |
Locus ID | 8675 |
UniProt ID | O14662 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | SNARE interactions in vesicular transport |
Gene Summary | This gene encodes a protein that is a member of the syntaxin or t-SNARE (target-SNAP receptor) family. These proteins are found on cell membranes and serve as the targets for V-SNARES (vesicle-SNAP receptors) permitting specific synaptic vesicle docking and fusion. A microdeletion in the region of chromosome 20 where this gene is located has been associated with pseudohypoparathyroidism type Ib. Multiple transcript variants have been found for this gene. Read-through transcription also exists between this gene and the neighboring downstream aminopeptidase-like 1 (NPEPL1) gene. [provided by RefSeq, Mar 2011] Transcript Variant: This variant (3) lacks an alternate in-frame exon in the 5' coding region, compared to variant 1, resulting in a shorter isoform (c), compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225462 | STX16 (Myc-DDK-tagged)-Human syntaxin 16 (STX16), transcript variant 3 |
CNY 3990.00 |
|
RC225462L3 | Lenti-ORF clone of STX16 (Myc-DDK-tagged)-Human syntaxin 16 (STX16), transcript variant 3 |
CNY 5890.00 |
|
RC225462L4 | Lenti-ORF clone of STX16 (mGFP-tagged)-Human syntaxin 16 (STX16), transcript variant 3 |
CNY 5890.00 |
|
RG225462 | STX16 (tGFP-tagged) - Human syntaxin 16 (STX16), transcript variant 3 |
CNY 4370.00 |
其它Syntaxin 16产品