p38 (CRK) (NM_016823) Human Untagged Clone

CAT#: SC324918

CRK (untagged)-Human v-crk sarcoma virus CT10 oncogene homolog (avian) (CRK), transcript variant II



  "NM_016823" in other vectors (6)

CNY 2400.00

CNY 6270.00


货期*
现货

规格
    • 10 ug

Cited in 1 publication.

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


CRK rabbit polyclonal antibody
    • 25 ul

CNY 800.00
CNY 1280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CRKII; p38
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC324918 representing NM_016823.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGGGCAACTTCGACTCGGAGGAGCGGAGTAGCTGGTACTGGGGGAGGTTGAGTCGGCAGGAGGCG
GTGGCGCTGCTGCAGGGCCAGCGGCACGGGGTGTTCCTGGTGCGGGACTCGAGCACCAGCCCCGGGGAC
TATGTGCTCAGCGTCTCAGAGAACTCGCGCGTCTCCCACTACATCATCAACAGCAGCGGCCCGCGCCCG
CCGGTGCCACCGTCGCCCGCCCAGCCTCCGCCCGGGGTGAGCCCCTCCAGACTCCGAATAGGAGATCAA
GAGTTTGATTCATTGCCTGCTTTACTGGAATTCTACAAAATACACTATTTGGACACTACAACGTTGATA
GAACCAGTTTCCAGATCCAGGCAGGGTAGTGGAGTGATTCTCAGGCAGGAGGAGGCGGAGTATGTGCGA
GCCCTCTTTGACTTTAATGGGAATGATGAGGAAGATCTTCCCTTTAAGAAAGGAGACATCTTGAGAATC
CGGGACAAGCCTGAAGAGCAGTGGTGGAATGCGGAGGACAGCGAAGGCAAGAGAGGGATGATTCCAGTC
CCTTACGTCGAGAAGTATAGACCTGCCTCCGCCTCAGTATCGGCTCTGATTGGAGGTAACCAGGAGGGT
TCCCACCCACAGCCACTGGGTGGGCCGGAGCCTGGGCCCTATGCCCAACCCAGCGTCAACACTCCGCTC
CCTAACCTCCAGAATGGGCCCATATATGCCAGGGTTATCCAGAAGCGAGTCCCCAATGCCTACGACAAG
ACAGCCTTGGCTTTGGAGGTCGGTGAGCTGGTAAAGGTTACGAAGATTAATGTGAGTGGTCAGTGGGAA
GGGGAGTGTAATGGCAAACGAGGTCACTTCCCATTCACACATGTCCGTCTGCTGGATCAACAGAATCCC
GATGAGGACTTCAGCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_016823
Insert Size 915 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_016823.3
RefSeq Size 3225 bp
RefSeq ORF 915 bp
Locus ID 1398
UniProt ID P46108
Domains SH2, SH3
Protein Families Druggable Genome, Transcription Factors
Protein Pathways Chemokine signaling pathway, Chronic myeloid leukemia, ErbB signaling pathway, Fc gamma R-mediated phagocytosis, Focal adhesion, Insulin signaling pathway, MAPK signaling pathway, Neurotrophin signaling pathway, Pathways in cancer, Regulation of actin cytoskeleton, Renal cell carcinoma
MW 33.8 kDa
Gene Summary This gene encodes a member of an adapter protein family that binds to several tyrosine-phosphorylated proteins. The product of this gene has several SH2 and SH3 domains (src-homology domains) and is involved in several signaling pathways, recruiting cytoplasmic proteins in the vicinity of tyrosine kinase through SH2-phosphotyrosine interaction. The N-terminal SH2 domain of this protein functions as a positive regulator of transformation whereas the C-terminal SH3 domain functions as a negative regulator of transformation. Two alternative transcripts encoding different isoforms with distinct biological activity have been described. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (II) includes an alternate segment, compared to variant I, resulting in a longer protein (isoform a) that has a distinct C-terminus and an additional SH3 domain, compared to isoform b. Isoform a is a negative modulator of transformation activity.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Other Versions

Customer Reviews 
Loading...