VDAC3 (NM_001135694) Human Untagged Clone
CAT#: SC324880
VDAC3 (untagged)-Human voltage-dependent anion channel 3 (VDAC3), transcript variant 1
CNY 3864.00
CNY 6270.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | HD-VDAC3; VDAC-3 |
| Vector | pCMV6-XL4 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF sequence for NM_001135694 edited
ATGTGTAACACACCAACGTACTGTGACCTAGGAAAGGCTGCTAAGGATGTCTTCAACAAA GGATATGGCTTTGGCATGGTCAAGATAGACCTGAAAACCAAGTCTTGTAGTGGAGTGATG GAATTTTCTACTTCTGGTCATGCTTACACTGATACAGGGAAAGCATCAGGCAACCTAGAA ACCAAATATAAGGTCTGTAACTATGGACTTACCTTCACCCAGAAATGGAACACAGACAAT ACTCTAGGGACAGAAATCTCTTGGGAGAATAAGTTGGCTGAAGGGTTGAAACTGACTCTT GATACCATATTTGTACCGAACACAGGAAAGAAGAGTGGGAAATTGAAGGCCTCCTATAAA CGGGATTGTTTTAGTGTTGGCAGTAATGTTGATATAGATTTTTCTGGACCAACCATCTAT GGCTGGGCTGTGTTGGCCTTCGAAGGGTGGCTTGCTGGCTATCAGATGAGTTTTGACACA GCCAAATCCAAACTGTCACAGAATAATTTCGCCCTGGGTTACAAGGCTGCGGACTTCCAG CTGCACACACATGTGAACGATGGCACTGAATTTGGAGGTTCTATCTACCAGAAGGTGAAT GAGAAGATTGAAACATCCATAAACCTTGCTTGGACAGCTGGGAGTAACAACACCCGTTTT GGCATTGCTGCTAAGTACATGCTGGATTGTAGAACTTCTCTCTCTGCTAAAGTAAATAAT GCCAGCCTGATTGGACTGGGTTATACTCAGACCCTTCGACCAGGAGTCAAATTGACTTTA TCAGCTTTAATCGATGGGAAGAACTTCAGTGCAGGAGGTCACAAGGTTGGCTTGGGATTT GAACTGGAAGCTTAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001135694 |
| Insert Size | 1557 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001135694.1, NP_001129166.1 |
| RefSeq Size | 1557 bp |
| RefSeq ORF | 1557 bp |
| Locus ID | 7419 |
| UniProt ID | Q9Y277 |
| Protein Families | Druggable Genome, Ion Channels: Other |
| Protein Pathways | Calcium signaling pathway, Huntington's disease, Parkinson's disease |
| Gene Summary | This gene encodes a voltage-dependent anion channel (VDAC), and belongs to the mitochondrial porin family. VDACs are small, integral membrane proteins that traverse the outer mitochondrial membrane and conduct ATP and other small metabolites. They are known to bind several kinases of intermediary metabolism, thought to be involved in translocation of adenine nucleotides, and are hypothesized to form part of the mitochondrial permeability transition pore, which results in the release of cytochrome c at the onset of apoptotic cell death. Alternatively transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Oct 2011] Transcript Variant: This variant (2) contains an additional, in-frame 3 nt coding exon compared to variant 1. This results in an isoform (2) that is 1 aa longer than isoform 1. The short exon is supported by PMID:10833333, and orthologs in mouse, rat and bovine. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC227390 | VDAC3 (Myc-DDK-tagged)-Human voltage-dependent anion channel 3 (VDAC3), transcript variant 1 |
CNY 3990.00 |
|
| RC227390L3 | Lenti-ORF clone of VDAC3 (Myc-DDK-tagged)-Human voltage-dependent anion channel 3 (VDAC3), transcript variant 1 |
CNY 5890.00 |
|
| RC227390L4 | Lenti-ORF clone of VDAC3 (mGFP-tagged)-Human voltage-dependent anion channel 3 (VDAC3), transcript variant 1 |
CNY 5890.00 |
|
| RG227390 | VDAC3 (tGFP-tagged) - Human voltage-dependent anion channel 3 (VDAC3), transcript variant 1 |
CNY 4370.00 |
