HS2ST1 (NM_001134492) Human Untagged Clone

CAT#: SC324816

HS2ST1 (untagged)-Human heparan sulfate 2-O-sulfotransferase 1 (HS2ST1), transcript variant 2



  "NM_001134492" in other vectors (4)

CNY 2400.00

CNY 3990.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Antibody against HS2ST1
    • 400 ul

CNY 6160.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms dJ604K5.2; NFSRA
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_001134492 edited
ATGGGGCTCCTCAGGATTATGATGCCGCCCAAGTTGCAGCTGCTGGCGGTGGTGGCCTTC
GCGGTGGCGATGCTCTTCTTGGAAAACCAGATCCAGAAACTGGAGGAGTCCCGCTCGAAG
CTAGAAAGGGCTATTGCAAGACACGAAGTCCGAGAAATTGAGCAGCGACATACAATGGAT
GGCCCTCGGCAAGATGCCACTTTAGATGAGGAAGAGGACATGGTGATCATTTATAACAGA
GTTCCCAAAACGGCAAGCACTTCATTTACCAATATCGCCTATGACCTGTGTGCAAAGAAT
AAATACCATGTCCTTCATATCAACACTACCAAAAATAATCCAGTGATGTCATTGCAAGAT
CAGGTGCGCTTTGTAAAGAATATAACTTCCTGGAAAGAGATGAAACCAGGATTTTATCAT
GGACACGTTTCTTACTTGGATTTTGCAAAATTTGGTGTGAAGAAGAAACCAATTTACATT
AATGTCATAAGGGATCCTATTGAGAGGCTAGTTTCTTATTATTACTTTCTGAGATTTGGA
GATGATTATAGACCAGGGTTACGGAGACGAAAACAAGGAGACAAAAAGACCTTTGATGAA
TGTGTAGCAGAAGGTGGCTCAGACTGTGCTCCAGAGAAGCTCTGGCTTCAAATCCCGTTC
TTCTGTGGCCATAGCTCCGAATGCTGGTAG
Restriction Sites Please inquire     
ACCN NM_001134492
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001134492.1, NP_001127964.1
RefSeq Size 1623 bp
RefSeq ORF 690 bp
Locus ID 9653
UniProt ID Q7LGA3
Protein Pathways Heparan sulfate biosynthesis
Gene Summary Heparan sulfate biosynthetic enzymes are key components in generating a myriad of distinct heparan sulfate fine structures that carry out multiple biologic activities. This gene encodes a member of the heparan sulfate biosynthetic enzyme family that transfers sulfate to the 2 position of the iduronic acid residue of heparan sulfate. The disruption of this gene resulted in no kidney formation in knockout embryonic mice, indicating that the absence of this enzyme may interfere with the signaling required for kidney formation. Two alternatively spliced transcript variants that encode different proteins have been found for this gene. [provided by RefSeq, Aug 2008]
Transcript Variant: This variant (2) uses a different splice site in the 3' coding region and lacks some coding region segments, compared to variant 1. The resulting protein (isoform 2) has a shorter C-terminus when it is compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from transcript and genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...