HS2ST1 (NM_001134492) Human Untagged Clone
CAT#: SC324816
HS2ST1 (untagged)-Human heparan sulfate 2-O-sulfotransferase 1 (HS2ST1), transcript variant 2
CNY 2400.00
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | dJ604K5.2; NFSRA |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_001134492 edited
ATGGGGCTCCTCAGGATTATGATGCCGCCCAAGTTGCAGCTGCTGGCGGTGGTGGCCTTC GCGGTGGCGATGCTCTTCTTGGAAAACCAGATCCAGAAACTGGAGGAGTCCCGCTCGAAG CTAGAAAGGGCTATTGCAAGACACGAAGTCCGAGAAATTGAGCAGCGACATACAATGGAT GGCCCTCGGCAAGATGCCACTTTAGATGAGGAAGAGGACATGGTGATCATTTATAACAGA GTTCCCAAAACGGCAAGCACTTCATTTACCAATATCGCCTATGACCTGTGTGCAAAGAAT AAATACCATGTCCTTCATATCAACACTACCAAAAATAATCCAGTGATGTCATTGCAAGAT CAGGTGCGCTTTGTAAAGAATATAACTTCCTGGAAAGAGATGAAACCAGGATTTTATCAT GGACACGTTTCTTACTTGGATTTTGCAAAATTTGGTGTGAAGAAGAAACCAATTTACATT AATGTCATAAGGGATCCTATTGAGAGGCTAGTTTCTTATTATTACTTTCTGAGATTTGGA GATGATTATAGACCAGGGTTACGGAGACGAAAACAAGGAGACAAAAAGACCTTTGATGAA TGTGTAGCAGAAGGTGGCTCAGACTGTGCTCCAGAGAAGCTCTGGCTTCAAATCCCGTTC TTCTGTGGCCATAGCTCCGAATGCTGGTAG |
Restriction Sites | Please inquire |
ACCN | NM_001134492 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001134492.1, NP_001127964.1 |
RefSeq Size | 1623 bp |
RefSeq ORF | 690 bp |
Locus ID | 9653 |
UniProt ID | Q7LGA3 |
Protein Pathways | Heparan sulfate biosynthesis |
Gene Summary | Heparan sulfate biosynthetic enzymes are key components in generating a myriad of distinct heparan sulfate fine structures that carry out multiple biologic activities. This gene encodes a member of the heparan sulfate biosynthetic enzyme family that transfers sulfate to the 2 position of the iduronic acid residue of heparan sulfate. The disruption of this gene resulted in no kidney formation in knockout embryonic mice, indicating that the absence of this enzyme may interfere with the signaling required for kidney formation. Two alternatively spliced transcript variants that encode different proteins have been found for this gene. [provided by RefSeq, Aug 2008] Transcript Variant: This variant (2) uses a different splice site in the 3' coding region and lacks some coding region segments, compared to variant 1. The resulting protein (isoform 2) has a shorter C-terminus when it is compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from transcript and genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225282 | HS2ST1 (Myc-DDK-tagged)-Human heparan sulfate 2-O-sulfotransferase 1 (HS2ST1), transcript variant 2 |
CNY 3990.00 |
|
RC225282L3 | Lenti-ORF clone of HS2ST1 (Myc-DDK-tagged)-Human heparan sulfate 2-O-sulfotransferase 1 (HS2ST1), transcript variant 2 |
CNY 5890.00 |
|
RC225282L4 | Lenti-ORF clone of HS2ST1 (mGFP-tagged)-Human heparan sulfate 2-O-sulfotransferase 1 (HS2ST1), transcript variant 2 |
CNY 5890.00 |
|
RG225282 | HS2ST1 (tGFP-tagged) - Human heparan sulfate 2-O-sulfotransferase 1 (HS2ST1), transcript variant 2 |
CNY 4370.00 |