SINHCAF (NM_001135812) Human Untagged Clone
CAT#: SC324801
FAM60A (untagged)-Human family with sequence similarity 60, member A (FAM60A), transcript variant 3
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | C12orf14; FAM60A; L4; TERA |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC324801 representing NM_001135812.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTTTGGTTTTCACAAGCCAAAGATGTACCGAAGTATAGAGGGCTGCTGTATTTGCAGAGCTAAGTCC TCCAGTTCTCGATTCACTGACAGTAAACGCTATGAAAAGGACTTCCAGAGCTGTTTTGGATTGCATGAG ACTCGTTCAGGAGACATCTGCAATGCCTGTGTCCTGCTTGTGAAAAGATGGAAGAAGTTGCCAGCAGGA TCAAAAAAAAACTGGAATCATGTGGTAGATGCAAGGGCTGGACCCAGTCTAAAGACTACATTGAAACCA AAGAAAGTGAAAACTCTATCTGGGAACAGGATAAAAAGCAACCAGATCAGTAAACTGCAGAAGGAATTT AAACGTCATAATTCTGATGCTCACAGTACCACCTCAAGTGCCTCCCCAGCTCAATCTCCTTGTTACAGT AACCAGTCAGATGACGGCTCAGATACAGAGATGGCTTCTGGTTCTAACAGAACACCAGTTTTTTCCTTT TTAGATCTCACTTACTGGAAAAGACAGAAGATATGTTGTGGGATCATCTATAAAGGCCGTTTTGGGGAA GTCCTCATTGACACACATCTCTTCAAGCCTTGCTGCAGCAATAAGAAAGCAGCTGCTGAGAAGCCAGAG GAGCAGGGGCCAGAGCCTCTGCCCATCTCCACTCAGGAGTGGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001135812 |
Insert Size | 666 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001135812.1 |
RefSeq Size | 3030 bp |
RefSeq ORF | 666 bp |
Locus ID | 58516 |
UniProt ID | Q9NP50 |
MW | 24.9 kDa |
Gene Summary | Subunit of the Sin3 deacetylase complex (Sin3/HDAC), this subunit is important for the repression of genes encoding components of the TGF-beta signaling pathway (PubMed:22865885, PubMed:22984288). Core component of a SIN3A complex (composed of at least SINHCAF, SIN3A, HDAC1, SAP30, RBBP4, OGT and TET1) present in embryonic stem (ES) cells. Promotes the stability of SIN3A and its presence on chromatin and is essential for maintaining the potential of ES cells to proliferate rapidly, while ensuring a short G1-phase of the cell cycle, thereby preventing premature lineage priming (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) lacks a segment in the 5' UTR, compared to variant 1. Variants 1, 2, and 3 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227918 | FAM60A (Myc-DDK-tagged)-Human family with sequence similarity 60, member A (FAM60A), transcript variant 3 |
CNY 2,400.00 |
|
RC227918L1 | Lenti ORF clone of Human family with sequence similarity 60, member A (FAM60A), transcript variant 3, Myc-DDK-tagged |
CNY 4,800.00 |
|
RC227918L2 | Lenti ORF clone of Human family with sequence similarity 60, member A (FAM60A), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
RC227918L3 | Lenti ORF clone of Human family with sequence similarity 60, member A (FAM60A), transcript variant 3, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC227918L4 | Lenti ORF clone of Human family with sequence similarity 60, member A (FAM60A), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
RG227918 | FAM60A (tGFP-tagged) - Human family with sequence similarity 60, member A (FAM60A), transcript variant 3 |
CNY 4,370.00 |
其它SINHCAF产品