Cyclin D3 (CCND3) (NM_001136017) Human Untagged Clone
CAT#: SC324791
CCND3 (untagged)-Human cyclin D3 (CCND3), transcript variant 1
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC324791 representing NM_001136017.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAACTACCTGGATCGCTACCTGTCTTGCGTCCCCACCCGAAAGGCGCAGTTGCAGCTCCTGGGTGCG GTCTGCATGCTGCTGGCCTCCAAGCTGCGCGAGACCACGCCCCTGACCATCGAAAAACTGTGCATCTAC ACCGACCACGCTGTCTCTCCCCGCCAGTTGCGGGACTGGGAGGTGCTGGTCCTAGGGAAGCTCAAGTGG GACCTGGCTGCTGTGATTGCACATGATTTCCTGGCCTTCATTCTGCACCGGCTCTCTCTGCCCCGTGAC CGACAGGCCTTGGTCAAAAAGCATGCCCAGACCTTTTTGGCCCTCTGTGCTACAGATTATACCTTTGCC ATGTACCCGCCATCCATGATCGCCACGGGCAGCATTGGGGCTGCAGTGCAAGGCCTGGGTGCCTGCTCC ATGTCCGGGGATGAGCTCACAGAGCTGCTGGCAGGGATCACTGGCACTGAAGTGGACTGCCTGCGGGCC TGTCAGGAGCAGATCGAAGCTGCACTCAGGGAGAGCCTCAGGGAAGCCTCTCAGACCAGCTCCAGCCCA GCGCCCAAAGCCCCCCGGGGCTCCAGCAGCCAAGGGCCCAGCCAGACCAGCACTCCTACAGATGTCACA GCCATACACCTGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001136017 |
Insert Size | 636 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001136017.3 |
RefSeq Size | 2099 bp |
RefSeq ORF | 636 bp |
Locus ID | 896 |
UniProt ID | P30281 |
Protein Families | Druggable Genome |
Protein Pathways | Cell cycle, Focal adhesion, Jak-STAT signaling pathway, p53 signaling pathway, Wnt signaling pathway |
MW | 22.9 kDa |
Gene Summary | The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin forms a complex with and functions as a regulatory subunit of CDK4 or CDK6, whose activtiy is required for cell cycle G1/S transition. This protein has been shown to interact with and be involved in the phosphorylation of tumor suppressor protein Rb. The CDK4 activity associated with this cyclin was reported to be necessary for cell cycle progression through G2 phase into mitosis after UV radiation. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008] Transcript Variant: This variant (1) differs in the 5' UTR and coding sequence, and represents use of an alternate promoter, compared to variant 2. The resulting isoform (1) is shorter at the N-terminus compared to isoform 2. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227101 | CCND3 (Myc-DDK-tagged)-Human cyclin D3 (CCND3), transcript variant 1 |
CNY 2400.00 |
|
RC227101L3 | Lenti-ORF clone of CCND3 (Myc-DDK-tagged)-Human cyclin D3 (CCND3), transcript variant 1 |
CNY 5890.00 |
|
RC227101L4 | Lenti-ORF clone of CCND3 (mGFP-tagged)-Human cyclin D3 (CCND3), transcript variant 1 |
CNY 5890.00 |
|
RG227101 | CCND3 (tGFP-tagged) - Human cyclin D3 (CCND3), transcript variant 1 |
CNY 4370.00 |
其它Cyclin D3产品