UCK (UCK1) (NM_001135954) Human Untagged Clone
CAT＃: SC324784
UCK1 (untagged)-Human uridine-cytidine kinase 1 (UCK1), transcript variant 2
CNY 3990.00
Product images
CNY 1999.00
CNY 2700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | URK1 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_001135954, the custom clone sequence may differ by one or more nucleotides
ATGGCTTCGGCGGGAGGCGAAGACTGCGAGAGCCCCGCGCCGGAGGCCGACCGTCCGCAC CAGCGGCCCTTCCTGATAGGGGTGAGCGGCGGCACTGCCAGCGGGAAGTCGACCGTGTGT GAGAAGATCATGGAGTTGCTGGGACAGAACGAGGTGGAACAGCGGCAGCGGAAGGTGGTC ATCCTGAGCCAGGACAGGTTCTACAAGGTCCTGACGGCAGAGCAGAAGGCCAAGGCCTTG AAAGGACAGTACAATTTTGACCATCCAGATGCCTTTGATAATGATTTGATGCACAGGACT CTGAAGAACATCGTGGAGGGCAAAACGGTGGAGGTGCCGACCTATGATTTTGTGACACAC TCAAGGTTACCAGAGACCACGGTGGTCTACCCTGCGGACGTGGTTCTGTTTGAGGGCATC TTGGTGTTCTACAGCCAGGAGATCCGGGACATGTTCCACCTGCGCCTCTTCGTGGACACC GACTCCGACGTCAGGCTGTCTCGAAGAGACAAAGAAGTATGCCGATGTGATCATCCCGCG AGGAGTGGACAATATGGTTGCCATCAACCTGATCGTGCAGCACATCCAGGACATTCTGAA TGG |
| Restriction Sites | Please inquire |
| ACCN | NM_001135954 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001135954.1, NP_001129426.1 |
| RefSeq Size | 2096 bp |
| RefSeq ORF | 606 bp |
| Locus ID | 83549 |
| UniProt ID | Q9HA47 |
| Protein Families | Druggable Genome |
| Protein Pathways | Drug metabolism - other enzymes, Metabolic pathways, Pyrimidine metabolism |
| Gene Summary | This gene encodes a uridine-cytidine kinase that catalyzes the phosphorylation of uridine and cytidine to uridine monophosphate (UMP) and cytidine monophosphate (CMP) but not the phosphorylation of deoxyribonucleosides or purine ribonucleosides. This enzyme can also phosphorylate uridine and cytidine analogs and uses both ATP and GTP as a phosphate donor. Alternative splicing results in multiple splice variants encoding distinct isoforms. [provided by RefSeq, May 2012] Transcript Variant: This variant (2) lacks an exon in the 3' coding region which results in a frameshift and an early stop codon, compared to variant 1. This variant encodes isoform b which has a shorter and distinct C-terminus, compared to isoform a. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC226683 | UCK1 (Myc-DDK-tagged)-Human uridine-cytidine kinase 1 (UCK1), transcript variant 2 |
CNY 2400.00 |
|
| RC226683L3 | Lenti ORF clone of Human uridine-cytidine kinase 1 (UCK1), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC226683L4 | Lenti ORF clone of Human uridine-cytidine kinase 1 (UCK1), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
| RG226683 | UCK1 (tGFP-tagged) - Human uridine-cytidine kinase 1 (UCK1), transcript variant 2 |
CNY 4370.00 |
