PRELID3A (NM_001142405) Human Untagged Clone
CAT＃: SC324762
SLMO1 (untagged)-Human slowmo homolog 1 (Drosophila) (SLMO1), transcript variant 1
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | C18orf43; HFL-EDDG1; SLMO1 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC324762 representing NM_001142405.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAAGATCTGGAGCTCGGAGCACGTGTTTGGCCACCCGTGGGACACGGTCATCCAGGCGGCCATGCGC AAGTACCCGAACCCGATGAACCCGAGCGTGCTGGGCGTGGATGTGCTACAGCGCCGCGTGGACGGCCGC GGCCGCCTGCACAGCTTGCGCCTGCTCAGCACCGAGTGGGGGCTGCCCAGCCTCGTGAGAGCGATTTTG GGAACCAGTAGGACATTGACATACATCCGAGAACATTCTGTGGTGGATCCAGTGGAAAAGAAAATGGAA CTTTGTTCTACCAATATCACACTCACAAATTTGGTGTCAGTTAATGAGAGGTTGGTGTACACACCTCAT CCAGAGAACCCAGAAATGACCGTGCTCACACAAGAAGCCATCATCACTGTGAAGGGGATTAGCCTTGGT AGTTATTTGGAAAGTTTAATGGCCAATACGATATCATCCAATGCAAAGAAGGGGTGGGCTGCTATCGAG TGGATAATTGAACACTCTGAAAGCGCTGTGAGCTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001142405 |
| Insert Size | 519 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001142405.1 |
| RefSeq Size | 1734 bp |
| RefSeq ORF | 519 bp |
| Locus ID | 10650 |
| UniProt ID | Q96N28 |
| MW | 19.2 kDa |
| Gene Summary | In vitro, the TRIAP1:PRELID3A complex mediates the transfer of phosphatidic acid (PA) between liposomes and probably functions as a PA transporter across the mitochondrion intermembrane space. Phosphatidic acid import is required for cardiolipin (CL) synthesis in the mitochondrial inner membrane.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the more predominant transcript. Transcript variants 1 and 2 encode the same isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no quality transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC227440 | SLMO1 (Myc-DDK-tagged)-Human slowmo homolog 1 (Drosophila) (SLMO1), transcript variant 1 |
CNY 2400.00 |
|
| RC227440L3 | Lenti ORF clone of Human slowmo homolog 1 (Drosophila) (SLMO1), transcript variant 1, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC227440L4 | Lenti ORF clone of Human slowmo homolog 1 (Drosophila) (SLMO1), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
| RG227440 | SLMO1 (tGFP-tagged) - Human slowmo homolog 1 (Drosophila) (SLMO1), transcript variant 1 |
CNY 4370.00 |
其它PRELID3A产品
