CDKN3 (NM_001130851) Human Untagged Clone

CAT#: SC324761

CDKN3 (untagged)-Human cyclin-dependent kinase inhibitor 3 (CDKN3), transcript variant 2



  "NM_001130851" in other vectors (4)

CNY 3990.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
CDKN3 mouse monoclonal antibody, clone OTI2E11 (formerly 2E11)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CDI1; CIP2; KAP; KAP1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC324761 representing NM_001130851.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAAGCCGCCCAGTTCAATACAAACAAGTTGTAAATTTAAAGATGTTAGAAGAAATGTCCAAAAAGAT
ACAGAAGAACTAAAGAGCTGTGGTATACAAGACATATTTGTTTTCTGCACCAGAGGGGAACTGTCAAAA
TATAGAGTCCCAAACCTTCTGGATCTCTACCAGCAATGTGGAATTATCACCCATCATCATCCAATCGCA
GATGGAGGGACTCCTGACATAGCCAGCTGCTGTGAAATAATGGAAGAGCTTACAACCTGCCTTAAAAAT
TACCGAAAAACCTTAATACACTGCTATGGAGGACTTGGGAGATCTTGTCTTGTAGCTGCTTGTCTCCTA
CTATACCTGTCTGACACAATATCACCAGAGCAAGCCATAGACAGCCTGCGAGACCTAAGAGGATCCGGG
GCAATACAGACCATCAAGCAATACAATTATCTTCATGAGTTTCGGGACAAATTAGCTGCACATCTATCA
TCAAGAGATTCACAATCAAGATCTGTATCAAGATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001130851
Insert Size 519 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001130851.1
RefSeq Size 786 bp
RefSeq ORF 519 bp
Locus ID 1033
UniProt ID Q16667
Protein Families Druggable Genome, Phosphatase
MW 19.4 kDa
Gene Summary The protein encoded by this gene belongs to the dual specificity protein phosphatase family. It was identified as a cyclin-dependent kinase inhibitor, and has been shown to interact with, and dephosphorylate CDK2 kinase, thus prevent the activation of CDK2 kinase. This gene was reported to be deleted, mutated, or overexpressed in several kinds of cancers. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
Transcript Variant: This variant (2) lacks an in-frame segment in the CDS, as compared to variant 1. The resulting isoform (2) lacks an internal segment, as compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...