EIF5A (NM_001143761) Human Untagged Clone

CAT#: SC324740

EIF5A (untagged)-Human eukaryotic translation initiation factor 5A (EIF5A), transcript variant C



  "NM_001143761" in other vectors (4)

CNY 3990.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit anti-EIF5A Polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

热销推荐


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms eIF-4D; EIF-5A; EIF5A1; eIF5AI
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC324740 representing NM_001143761.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCAGATGACTTGGACTTCGAGACAGGAGATGCAGGGGCCTCAGCCACCTTCCCAATGCAGTGCTCA
GCATTACGTAAGAATGGCTTTGTGGTGCTCAAAGGCCGGCCATGTAAGATCGTCGAGATGTCTACTTCG
AAGACTGGCAAGCACGGCCACGCCAAGGTCCATCTGGTTGGTATTGACATCTTTACTGGGAAGAAATAT
GAAGATATCTGCCCGTCAACTCATAATATGGATGTCCCCAACATCAAAAGGAATGACTTCCAGCTGATT
GGCATCCAGGATGGGTACCTATCACTGCTCCAGGACAGCGGGGAGGTACGAGAGGACCTTCGTCTCCCT
GAGGGAGACCTTGGCAAGGAGATTGAGCAGAAGTACGACTGTGGAGAAGAGATCCTGATCACGGTGCTG
TCTGCCATGACAGAGGAGGCAGCTGTTGCAATCAAGGCCATGGCAAAATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001143761
Insert Size 465 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001143761.1
RefSeq Size 1284 bp
RefSeq ORF 465 bp
Locus ID 1984
UniProt ID P63241
MW 16.8 kDa
Gene Summary mRNA-binding protein involved in translation elongation. Has an important function at the level of mRNA turnover, probably acting downstream of decapping. Involved in actin dynamics and cell cycle progression, mRNA decay and probably in a pathway involved in stress response and maintenance of cell wall integrity. With syntenin SDCBP, functions as a regulator of p53/TP53 and p53/TP53-dependent apoptosis. Regulates also TNF-alpha-mediated apoptosis. Mediates effects of polyamines on neuronal process extension and survival. May play an important role in brain development and function, and in skeletal muscle stem cell differentiation. Also described as a cellular cofactor of human T-cell leukemia virus type I (HTLV-1) Rex protein and of human immunodeficiency virus type 1 (HIV-1) Rev protein, essential for mRNA export of retroviral transcripts.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (C) contains an alternate in-frame exon in the 5' coding region and uses a downstream start codon compared to variant A. The encoded isoform (B) has a shorter N-terminus compared to isoform A. Variants B, C, and D encode the same isoform.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...