NDUFB11 (NM_001135998) Human Untagged Clone
CAT#: SC324738
NDUFB11 (untagged)-Human NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 11, 17.3kDa (NDUFB11), nuclear gene encoding mitochondrial protein, transcript variant 2
CNY 3990.00
Product images
CNY 1999.00
CNY 2700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CI-ESSS; ESSS; MC1DN30; Np15; NP17.3; P17.3 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC324738 representing NM_001135998.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCGGCTGGGCTGTTTGGTTTGAGCGCTCGCCGTCTTTTGGCGGCAGCGGCGACGCGAGGGCTCCCG GCCGCCCGCGTCCGCTGGGAATCTAGCTTCTCCAGGACTGTGGTCGCCCCGTCCGCTGTGGCGGGAAAG CGGCCCCCAGAACCGACCACACCGTGGCAAGAGGACCCAGAACCCGAGGACGAAAACTTGTATGAGAAG AACCCAGACTCCCATGGTTATGACAAGGACCCCGTTTTGGACGTCTGGAACATGCGACTTGTCTTCTTC TTTGGCGTCTCCATCATCCTGGTCCTTGGCAGCACCTTTGTGGCCTATCTGCCTGACTACAGGATGAAA GAGTGGTCCCGCCGCGAAGCTGAGAGGCTTGTGAAATACCGAGAGGCCAATGGCCTTCCCATCATGGAA TCCAACTGCTTCGACCCCAGCAAGATCCAGCTGCCAGAGGATGAGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001135998 |
| Insert Size | 462 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001135998.2 |
| RefSeq Size | 1108 bp |
| RefSeq ORF | 462 bp |
| Locus ID | 54539 |
| UniProt ID | Q9NX14 |
| Protein Families | Transmembrane |
| MW | 17.3 kDa |
| Gene Summary | The protein encoded by this gene is a subunit of the multisubunit NADH:ubiquinone oxidoreductase (complex I). Mammalian complex I is located at the mitochondrial inner membrane. This protein has NADH dehydrogenase activity and oxidoreductase activity. It transfers electrons from NADH to ubiquinone. Mutations in the human gene are associated with linear skin defects with multiple congenital anomalies 3 and mitochondrial complex I deficiency. [provided by RefSeq, Dec 2016] Transcript Variant: This variant (2) uses an alternate in_frame splice site in the 3' coding region, compared to variant 1. The encoded isoform (2) has a shorter C-terminus compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC226587 | NDUFB11 (Myc-DDK-tagged)-Human NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 11, 17.3kDa (NDUFB11), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 1200.00 |
|
| RC226587L3 | Lenti ORF clone of Human NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 11, 17.3kDa (NDUFB11), nuclear gene encoding mitochondrial protein, transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC226587L4 | Lenti ORF clone of Human NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 11, 17.3kDa (NDUFB11), nuclear gene encoding mitochondrial protein, transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
| RG226587 | NDUFB11 (tGFP-tagged) - Human NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 11, 17.3kDa (NDUFB11), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 4370.00 |
其它NDUFB11产品
