SCN4B (NM_001142349) Human Untagged Clone
CAT#: SC324716
SCN4B (untagged)-Human sodium channel, voltage-gated, type IV, beta (SCN4B), transcript variant 3
CNY 1200.00
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ATFB17; LQT10; Navbeta4 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>SC123982 representing NM_174934.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGCCCGGGGCTGGGGACGGAGGCAAAGCCCCGGCGAGATGGCTGGGCACTGGGCTTTTGGGCCTCTTC CTGCTCCCCGTAACCCTGTCGCTGGAGGTGTCTGTGGGAAAGGCCACCGACATCTACGCTGTCAATGGC ACGGAGATCCTGCTGCCCTGCACCTTCTCCAGCTGCTTTGGCTTCGAGGACCTCCACTTCCGGTGGACC TACAACAGCAGTGACGCATTCAAGATTCTCATAGAGGGGACTGTGAAGAATGAGAAGTCTGACCCCAAG GTGACGTTGAAAGACGATGACCGCATCACTCTGGTAGGCTCTACTAAGGAGAAGATGAACAACATTTCC ATTGTGCTGAGGGACCTGGAGTTCAGCGACACGGGCAAATACACCTGCCATGTGAAGAACCCCAAGGAG AATAATCTCCAGCACCACGCCACCATCTTCCTCCAAGTCGTTGATAGACTGGAAGAAGTGGACAACACA GTGACACTCATCATCCTGGCTGTCGTGGGCGGGGTCATCGGGCTCCTCATCCTCATCCTGCTGATCAAG AAACTCATCATCTTCATCCTGAAGAAGACTCGGGAGAAGAAGAAGGAGTGTCTCGTGAGCTCCTCGGGG AATGACAACACGGAGAACGGCTTGCCTGGCTCCAAGGCAGAGGAGAAACCACCTTCAAAAGTGTGA |
Restriction Sites | Please inquire |
ACCN | NM_001142349 |
Insert Size | 4500 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001142349.1, NP_001135821.1 |
RefSeq Size | 4516 bp |
RefSeq ORF | 357 bp |
Locus ID | 6330 |
UniProt ID | Q8IWT1 |
Protein Families | Ion Channels: Sodium, Transmembrane |
Gene Summary | The protein encoded by this gene is one of several sodium channel beta subunits. These subunits interact with voltage-gated alpha subunits to change sodium channel kinetics. The encoded transmembrane protein forms interchain disulfide bonds with SCN2A. Defects in this gene are a cause of long QT syndrome type 10 (LQT10). Three protein-coding and one non-coding transcript variant have been found for this gene.[provided by RefSeq, Mar 2009] Transcript Variant: This variant (3) differs in the 5' UTR and 5' coding region, compared to variant 1. These differences cause translation initiation at an in-frame downstream ATG and an isoform (3) which has a shorter N-terminus, compared to isoform 1. Translation initiation from the start codon 197 nucleotides upstream would subject the transcript to nonsense-mediated mRNA decay (NMD). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227560 | SCN4B (Myc-DDK-tagged)-Human sodium channel, voltage-gated, type IV, beta (SCN4B), transcript variant 3 |
CNY 3990.00 |
|
RC227560L3 | Lenti-ORF clone of SCN4B (Myc-DDK-tagged)-Human sodium channel, voltage-gated, type IV, beta (SCN4B), transcript variant 3 |
CNY 5890.00 |
|
RC227560L4 | Lenti-ORF clone of SCN4B (mGFP-tagged)-Human sodium channel, voltage-gated, type IV, beta (SCN4B), transcript variant 3 |
CNY 5890.00 |
|
RG227560 | SCN4B (tGFP-tagged) - Human sodium channel, voltage-gated, type IV, beta (SCN4B), transcript variant 3 |
CNY 4370.00 |