TFB1M (NM_016020) Human Untagged Clone
CAT#: SC324517
TFB1M (untagged)-Human transcription factor B1, mitochondrial (TFB1M), nuclear gene encoding mitochondrial protein
CNY 3656.00
CNY 7220.00
Product images

CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CGI-75; CGI75; mtTFB; mtTFB1 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_016020.1
GAGCGGCGGTGAAGGTCCTGGGTGAGGTAGGGTTGGATGGTGCTTGCCGCGTATCATGGC
TGCCTCCGGAAAACTCAGCACTTGCCGTCTCCCTCCGTTGCCCACGATTCGAGAAATCAT TAAGTTGTTAAGACTGCAAGCAGCGAAGCAGCTATCACAGAATTTCCTCCTGGACTTGAG GCTGACAGATAAGATTGTAAGGAAAGCTGGCAATCTGACAAATGCTTATGTTTACGAAGT GGGCCCTGGGCCAGGGGGAATCACAAGATCTATTCTTAATGCCGACGTCGCTGAACTTCT GGTGGTTGAAAAGGACACTCGATTTATTCCTGGATTACAGATGCTTTCTGATGCAGCACC TGGGAAACTGAGAATTGTTCATGGAGATGTCTTGACATTTAAGGTAGAAAAGGCTTTTTC AGAAAGTCTTAAAAGACCCTGGGAAGATGATCCTCCAAATGTACATATTATTGGAAATCT GCCTTTTAGTGTTTCAACTCCACTGATTATCAAGTGGCTTGAAAATATTTCCTGTAGAGA TGGACCTTTTGTTTATGGCAGAACTCAGATGACTTTGACTTTTCAAAAGGAAGTGGCAGA GAGACTTGCAGCCAATACAGGAAGCAAACAGCGTAGTCGCCTCTCTGTTATGGCTCAGTA CCTCTGCAATGTTCGACACATCTTTACGATTCCAGGACAAGCTTTTGTCCCCAAACCAGA GGTGGACGTGGGCGTGGTGCACTTCACTCCCTTGATACAGCCCAAGATAGAGCAGCCATT CAAGCTGGTGGAAAAAGTGGTTCAGAATGTATTTCAGTTCCGAAGGAAATACTGCCATCG AGGGCTCAGAATGTTATTCCCTGAAGCGCAGCGCTTGGAAAGCACGGGCAGGCTGTTAGA GTTGGCAGACATAGACCCTACTCTTCGGCCCCGCCAGCTCTCCATCTCACACTTTAAGAG CCTCTGTGATGTATACAGAAAAATGTGTGATGAAGACCCACAACTCTTTGCATATAATTT CAGAGAAGAACTCAAGCGAAGAAAAAGCAAAAATGAAGAAAAAGAAGAGGATGACGCAGA GAATTACAGACTCTAGCTGCTGCCTGGGGGCGAGCAGCCTACCAGATGTCGATTTGCACT ACGTGGAGCTTCTTATATAGGTACTCTTTTGTCTTTACAGAGTGACGATACAAATGCCAA TGACCAGATGTGACTTATTTTCCTTTTACTATACAGCTTGGCAGAGAAAATAAATATCAT CAAATAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_016020 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_016020.1, NP_057104.1 |
RefSeq Size | 1290 bp |
RefSeq ORF | 1041 bp |
Locus ID | 51106 |
UniProt ID | Q8WVM0 |
Domains | rADc |
Protein Families | Transcription Factors |
Gene Summary | The protein encoded by this gene is a dimethyltransferase that methylates the conserved stem loop of mitochondrial 12S rRNA. The encoded protein also is part of the basal mitochondrial transcription complex and is necessary for mitochondrial gene expression. The methylation and transcriptional activities of this protein are independent of one another. Variations in this gene may influence the severity of aminoglycoside-induced deafness (AID).[provided by RefSeq, Aug 2010] Transcript Variant: This variant (1) encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC204643 | TFB1M (Myc-DDK-tagged)-Human transcription factor B1, mitochondrial (TFB1M), nuclear gene encoding mitochondrial protein |
CNY 3656.00 |
|
RC204643L1 | Lenti ORF clone of Human transcription factor B1, mitochondrial (TFB1M), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged |
CNY 6056.00 |
|
RC204643L2 | Lenti ORF clone of Human transcription factor B1, mitochondrial (TFB1M), nuclear gene encoding mitochondrial protein, mGFP tagged |
CNY 5890.00 |
|
RC204643L3 | Lenti ORF clone of Human transcription factor B1, mitochondrial (TFB1M), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged |
CNY 5890.00 |
|
RC204643L4 | Lenti ORF clone of Human transcription factor B1, mitochondrial (TFB1M), nuclear gene encoding mitochondrial protein, mGFP tagged |
CNY 5890.00 |
|
RG204643 | TFB1M (tGFP-tagged) - Human transcription factor B1, mitochondrial (TFB1M), nuclear gene encoding mitochondrial protein |
CNY 5256.00 |
|
SC311121 | TFB1M (untagged)-Human transcription factor B1, mitochondrial (TFB1M), nuclear gene encoding mitochondrial protein |
CNY 3656.00 |