LIAS (NM_006859) Human Untagged Clone
CAT#: SC324499
LIAS (untagged)-Human lipoic acid synthetase (LIAS), nuclear gene encoding mitochondrial protein, transcript variant 1
CNY 3656.00
CNY 7220.00
| Cited in 1 publication. |
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | HGCLAS; HUSSY-01; LAS; LIP1; LS; PDHLD |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_006859.2
ATCCCTCAACCCCTGCACTGCGCTAGTCCTAAAGAGGAAATGTCTCTACGCTGCGGGGAT
GCAGCCCGCACCCTGGGGCCCCGGGTATTTGGGAGATATTTTTGCAGCCCAGTCAGACCG TTAAGCTCCTTGCCAGATAAAAAAAAGGAACTCCTACAGAATGGACCAGACCTTCAAGAT TTTGTATCTGGTGATCTTGCAGACAGGAGCACCTGGGATGAATATAAAGGAAACCTAAAA CGCCAGAAAGGAGAAAGGTTAAGACTACCTCCATGGCTAAAGACAGAGATTCCCATGGGG AAAAATTACAATAAACTGAAAAATACTTTGCGGAATTTAAATCTCCATACAGTATGTGAG GAAGCTCGATGTCCCAATATTGGAGAGTGTTGGGGAGGTGGAGAATATGCCACCGCCACA GCCACGATCATGTTGATGGGTGACACATGTACAAGAGGTTGCAGATTTTGTTCTGTTAAG ACTGCAAGAAATCCTCCTCCACTGGATGCCAGTGAGCCCTACAATACTGCAAAGGCAATT GCAGAATGGGGTCTGGATTATGTTGTCCTGACATCTGTGGATCGAGATGATATGCCTGAT GGGGGAGCTGAACACATTGCAAAGACCGTATCATATTTAAAGGAAAGGAATCCAAAAATC CTTGTGGAGTGTCTTACTCCTGATTTTCGAGGTGATCTCAAAGCAATAGAAAAAGTTGCT CTGTCAGGATTAGATGTGTATGCACATAATGTAGAAACAGTCCCGGAATTACAGAGTAAG GTTCGTGATCCTCGGGTCAATTTTGATCAGTCCCTACGTGTACTGAAACATGCCAAGAAG GTTCAGCCTGATGTTATTTCTAAAACATCTATAATGTTGGGTTTAGGCGAGAATGATGAG CAAGTATATGCAACAATGAAAGCACTTCGTGAGGCAGATGTAGACTGCTTGACTTTAGGA CAATATATGCAGCCAACAAGGCGTCACCTTAAGGTTGAAGAATATATTACTCCTGAAAAA TTCAAATACTGGGAAAAAGTAGGAAATGAACTTGGATTTCATTATACTGCAAGTGGCCCT TTGGTGCGTTCTTCATATAAAGCAGGTGAATTTTTCCTGAAAAATCTAGTGGCTAAAAGA AAAACAAAAGACCTCTAAAACTTCAACAAGACCTTCAAGATCACAGAAATTTTTAAAATT TGATTCCAGTTAATAACAGAGGTGGTGCCAGAATGCCTGGACTGCAGTGGATGTACCCCA CCTCTTTGCTTAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_006859 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_006859.2, NP_006850.2 |
| RefSeq Size | 1743 bp |
| RefSeq ORF | 1119 bp |
| Locus ID | 11019 |
| UniProt ID | O43766 |
| Protein Pathways | Lipoic acid metabolism, Metabolic pathways |
| Gene Summary | The protein encoded by this gene belongs to the biotin and lipoic acid synthetases family. Localized in the mitochondrion, this iron-sulfur enzyme catalyzes the final step in the de novo pathway for the biosynthesis of lipoic acid, a potent antioxidant. The deficient expression of this enzyme has been linked to conditions such as diabetes, atherosclerosis and neonatal-onset epilepsy. Alternative splicing occurs at this locus, and several transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Aug 2020] Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Variant nonketotic hyperglycinemia is caused by mutations in LIAS, BOLA3 and the novel gene GLRX5
,Baker, PR;Friederich, MW;Swanson, MA;Shaikh, T;Bhattacharya, K;Scharer, GH;Aicher, J;Creadon-Swindell, G;Geiger, E;Maclean, KN;Lee, WT;Deshpande, C;Freckmann, ML;Shih, LY;Wasserstein, M;Rasmussen, MB;Lund, AM;Procopis, P;Cameron, JM;Robinson, BH;Brown, GK;Brown, RM;Compton, AG;Dieckmann, CL;Collard, R;Coughlin, CR;Spector, E;Wempe, MF;Van Hove, JL;,
Brain Dec 2013.
,PubMed ID 24334290
[LIAS]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC204939 | LIAS (Myc-DDK-tagged)-Human lipoic acid synthetase (LIAS), nuclear gene encoding mitochondrial protein, transcript variant 1 |
CNY 3656.00 |
|
| RC204939L1 | Lenti ORF clone of Human lipoic acid synthetase (LIAS), nuclear gene encoding mitochondrial protein, transcript variant 1, Myc-DDK-tagged |
CNY 6056.00 |
|
| RC204939L2 | Lenti ORF clone of Human lipoic acid synthetase (LIAS), nuclear gene encoding mitochondrial protein, transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
| RC204939L3 | Lenti ORF clone of Human lipoic acid synthetase (LIAS), nuclear gene encoding mitochondrial protein, transcript variant 1, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC204939L4 | Lenti ORF clone of Human lipoic acid synthetase (LIAS), nuclear gene encoding mitochondrial protein, transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
| RG204939 | LIAS (tGFP-tagged) - Human lipoic acid synthetase (LIAS), nuclear gene encoding mitochondrial protein, transcript variant 1 |
CNY 5256.00 |
|
| SC111760 | LIAS (untagged)-Human lipoic acid synthetase (LIAS), nuclear gene encoding mitochondrial protein, transcript variant 1 |
CNY 7220.00 |
