TNNI1 (NM_003281) Human Untagged Clone

CAT#: SC324445

TNNI1 (untagged)-Human troponin I type 1 (skeletal, slow) (TNNI1)



  "NM_003281" in other vectors (7)

CNY 2400.00

CNY 2950.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
TNNI1 mouse monoclonal antibody, clone OTI8H8 (formerly 8H8)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms SSTNI; TNN1
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_003281.3 GGGGACAGTCTGCAGTCTACGGCGAGGCACAGGCCAGCCCAGCTCCACGAGGACTGAACA
AGGTGCTGTCTCACTGCCACCATGCCGGAAGTCGAGAGAAAACCCAAGATCACTGCCTCC
CGCAAACTCTTGCTGAAGAGCCTGATGCTGGCCAAGGCCAAGGAATGCTGGGAGCAGGAG
CACGAGGAGCGCGAGGCTGAGAAGGTGCGCTACCTGGCAGAGCGCATCCCCACGCTGCAG
ACCCGTGGCCTGTCCCTCAGTGCCCTGCAGGACCTGTGCCGGGAGCTGCACGCCAAGGTG
GAGGTGGTGGATGAGGAGCGATACGACATTGAGGCCAAATGCCTCCACAACACCAGGGAG
ATTAAGGACCTGAAGCTGAAGGTGATGGACCTCCGTGGGAAGTTCAAGCGCCCGCCCCTG
CGTCGAGTCCGTGTCTCGGCTGACGCCATGCTCCGGGCCCTGCTGGGCTCCAAGCACAAG
GTGTCCATGGATCTGCGGGCCAACCTCAAGTCTGTGAAGAAGGAAGACACAGAGAAGGAG
CGGCCTGTGGAGGTGGGTGACTGGAGGAAGAACGTGGAGGCCATGTCTGGCATGGAAGGC
CGGAAGAAGATGTTTGATGCCGCCAAGTCTCCGACCTCACAATAGAGGCCAGCTTGCTGT
GCTGCGCTCTGAGCTCCTGCTTCATGCTTCTTCTCCAACCCAGCTCACTCACCTCTCTGC
CTGTGTCTGGAGCATCCCTTCCCACCTCTCCCCCACTTCTTCCCTCCAGCCTGCATGCCC
TCCTCTGGAACTGGGATTAAACAGATACCCAAGAGGCAGGAAAAACGCGAGTGTCTGAAG
ACCTCACCCTGGCAGGGTGGGCTTCTATCCACCCATGAGGCACCTGGGGCTTCTCAGCCA
CCCCGTGGTGTAACAAGTGGAGGAGGAGGAGGGGGTGAGAACACCTTTCCTCCAGCCCTG
TGCCACACTCCTTCTATGTGTGTACAGTGTCCACAGGCATCACACCTTCTTCATTAAAAA
CCCAGTTTCCTGGGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_003281
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_003281.3, NP_003272.3
RefSeq Size 6162 bp
RefSeq ORF 564 bp
Locus ID 7135
UniProt ID P19237
Domains Troponin
Gene Summary Troponin proteins associate with tropomyosin and regulate the calcium sensitivity of the myofibril contractile apparatus of striated muscles. Troponin I (TnI), along with troponin T (TnT) and troponin C (TnC), is one of 3 subunits that form the troponin complex of the thin filaments of striated muscle. TnI is the inhibitory subunit; blocking actin-myosin interactions and thereby mediating striated muscle relaxation. The TnI subfamily contains three genes: TnI-skeletal-fast-twitch, TnI-skeletal-slow-twitch, and TnI-cardiac. The TnI-fast and TnI-slow genes are expressed in fast-twitch and slow-twitch skeletal muscle fibers, respectively, while the TnI-cardiac gene is expressed exclusively in cardiac muscle tissue. This gene encodes the Troponin-I-skeletal-slow-twitch protein. This gene is expressed in cardiac and skeletal muscle during early development but is restricted to slow-twitch skeletal muscle fibers in adults. The encoded protein prevents muscle contraction by inhibiting calcium-mediated conformational changes in actin-myosin complexes. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...