PEX7 (NM_000288) Human Untagged Clone
CAT#: SC324400
PEX7 (untagged)-Human peroxisomal biogenesis factor 7 (PEX7)
CNY 2400.00
CNY 2950.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | PBD9B; PTS2R; RCDP1; RD |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_000288.1
GGCTTCCGCGGCCGGGGCAGCGAGGGCCGGGGGCGGCGGGCGGGATGAGTGCGGTGTGCG
GTGGAGCGGCGCGGATGCTGCGGACGCCGGGACGCCACGGCTACGCCGCCGAGTTCTCCC CGTACCTGCCGGGCCGCCTGGCCTGCGCCACCGCGCAGCACTACGGCATCGCGGGCTGTG GAACCCTACTAATATTGGATCCAGATGAAGCTGGGCTAAGGCTTTTTAGAAGCTTTGACT GGAATGATGGTTTGTTTGATGTGACTTGGAGTGAGAACAACGAACATGTCCTCATCACCT GTAGTGGCGATGGCTCGCTGCAGCTCTGGGACACTGCCAAAGCTGCAGGGCCACTGCAAG TCTATAAAGAACACGCTCAGGAGGTGTATAGTGTTGATTGGAGCCAAACCAGAGGTGAAC AGCTTGTGGTGTCTGGCTCATGGGATCAAACTGTCAAATTGTGGGATCCAACTGTTGGAA AGTCTCTGTGCACCTTTAGAGGCCATGAAAGTATTATTTATAGCACAATCTGGTCTCCCC ACATCCCTGGTTGTTTTGCTTCAGCCTCAGGTGATCAGACTCTGAGAATATGGGATGTGA AGGCAGCAGGAGTAAGAATCGTGATTCCTGCACATCAGGCAGAAATCTTGAGTTGTGACT GGTGTAAATACAATGAGAATTTGCTGGTGACCGGGGCGGTTGACTGTAGTTTGAGAGGCT GGGACTTAAGGAATGTACGACAACCAGTGTTTGAACTTCTTGGTCATACCTATGCTATTA GGAGGGTGAAATTTTCACCATTTCATGCTTCTGTGCTGGCCTCTTGCTCGTATGATTTTA CTGTAAGATTCTGGAACTTTTCAAAGCCTGACTCTCTTCTTGAAACAGTGGAGCATCATA CAGAGTTTACTTGTGGTTTAGACTTCAGTCTTCAGAGCCCCACTCAGGTGGCTGACTGTT CTTGGGATGAAACAATAAAGATCTATGACCCTGCTTGTCTTACTATTCCTGCTTGAGATA CACTACTTTGGTCAGAAACAGAGGATGTTGGCTGAAGAACTGCCTAACAGCAAATAAATT AACTATGGAAAACATAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_000288 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_000288.1, NP_000279.1 |
| RefSeq Size | 1451 bp |
| RefSeq ORF | 972 bp |
| Locus ID | 5191 |
| UniProt ID | O00628 |
| Domains | WD40 |
| Protein Families | Druggable Genome |
| Gene Summary | This gene encodes the cytosolic receptor for the set of peroxisomal matrix enzymes targeted to the organelle by the peroxisome targeting signal 2 (PTS2). Defects in this gene cause peroxisome biogenesis disorders (PBDs), which are characterized by multiple defects in peroxisome function. There are at least 14 complementation groups for PBDs, with more than one phenotype being observed in cases falling into particular complementation groups. Although the clinical features of PBD patients vary, cells from all PBD patients exhibit a defect in the import of one or more classes of peroxisomal matrix proteins into the organelle. Defects in this gene have been associated with PBD complementation group 11 (PBD-CG11) disorders, rhizomelic chondrodysplasia punctata type 1 (RCDP1), and Refsum disease (RD). [provided by RefSeq, Oct 2008] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC202432 | PEX7 (Myc-DDK-tagged)-Human peroxisomal biogenesis factor 7 (PEX7) |
CNY 2400.00 |
|
| RC202432L1 | Lenti ORF clone of Human peroxisomal biogenesis factor 7 (PEX7), Myc-DDK-tagged |
CNY 4800.00 |
|
| RC202432L2 | Lenti ORF clone of Human peroxisomal biogenesis factor 7 (PEX7), mGFP tagged |
CNY 5890.00 |
|
| RC202432L3 | Lenti ORF clone of Human peroxisomal biogenesis factor 7 (PEX7), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC202432L4 | Lenti ORF clone of Human peroxisomal biogenesis factor 7 (PEX7), mGFP tagged |
CNY 5890.00 |
|
| RG202432 | PEX7 (tGFP-tagged) - Human peroxisomal biogenesis factor 7 (PEX7) |
CNY 4370.00 |
|
| SC119985 | PEX7 (untagged)-Human peroxisomal biogenesis factor 7 (PEX7) |
CNY 2400.00 |
