RPS9 (NM_001013) Human Untagged Clone
CAT#: SC324394
RPS9 (untagged)-Human ribosomal protein S9 (RPS9)
CNY 2400.00
CNY 2950.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | S9 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_001013.3
GTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATGCCAGTGGCCCGGAGCTGGG
TTTGTCGCAAAACTTATGTGACCCCGCGGAGACCCTTCGAGAAATCTCGTCTCGACCAAG AGCTGAAGCTGATCGGCGAGTATGGGCTCCGGAACAAACGTGAGGTCTGGAGGGTCAAAT TTACCCTGGCCAAGATCCGCAAGGCCGCCCGGGAACTGCTGACGCTTGATGAGAAGGACC CACGGCGTCTGTTCGAAGGCAACGCCCTGCTGCGGCGGCTGGTCCGCATTGGGGTGCTGG ATGAGGGCAAGATGAAGCTGGATTACATCCTGGGCCTGAAGATAGAGGATTTCTTAGAGA GACGCCTGCAGACCCAGGTCTTCAAGCTGGGCTTGGCCAAGTCCATCCACCACGCTCGCG TGCTGATCCGCCAGCGCCATATCAGGGTCCGCAAGCAGGTGGTGAACATCCCGTCCTTCA TTGTCCGCCTGGATTCCCAGAAGCACATCGACTTCTCTCTGCGCTCTCCCTACGGGGGTG GCCGCCCGGGCCGCGTGAAGAGGAAGAATGCCAAGAAGGGCCAGGGTGGGGCTGGGGCTG GAGACGACGAGGAGGAGGATTAAGTCCACCTGTCCCTCCTGGGCTGCTGGATTGTCTCGT TTTCCTGCCAAATAAACAGGATCAGCGCTTTACAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_001013 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001013.3, NP_001004.2 |
RefSeq Size | 753 bp |
RefSeq ORF | 585 bp |
Locus ID | 6203 |
UniProt ID | P46781 |
Domains | Ribosomal_S4, S4 |
Protein Pathways | Ribosome |
Gene Summary | Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S4P family of ribosomal proteins. It is located in the cytoplasm. Variable expression of this gene in colorectal cancers compared to adjacent normal tissues has been observed, although no correlation between the level of expression and the severity of the disease has been found. As is typical for genes encoding ribosomal proteins, multiple processed pseudogenes derived from this gene are dispersed through the genome. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1), as well as variants 2, 3, and 4, encodes isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC200772 | RPS9 (Myc-DDK-tagged)-Human ribosomal protein S9 (RPS9) |
CNY 2400.00 |
|
RC200772L1 | Lenti ORF clone of Human ribosomal protein S9 (RPS9), Myc-DDK-tagged |
CNY 4800.00 |
|
RC200772L2 | Lenti ORF clone of Human ribosomal protein S9 (RPS9), mGFP tagged |
CNY 5890.00 |
|
RC200772L3 | Lenti ORF clone of Human ribosomal protein S9 (RPS9), Myc-DDK-tagged |
CNY 5890.00 |
|
RC200772L4 | Lenti ORF clone of Human ribosomal protein S9 (RPS9), mGFP tagged |
CNY 5890.00 |
|
RG200772 | RPS9 (tGFP-tagged) - Human ribosomal protein S9 (RPS9) |
CNY 4370.00 |
|
SC119521 | RPS9 (untagged)-Human ribosomal protein S9 (RPS9) |
CNY 2400.00 |