GPRC5C (NM_022036) Human Untagged Clone

CAT#: SC324348

GPRC5C (untagged)-Human G protein-coupled receptor, family C, group 5, member C (GPRC5C), transcript variant 1



  "NM_022036" in other vectors (7)

CNY 3656.00

CNY 7220.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


GPRC5C rabbit polyclonal antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms RAIG-3; RAIG3
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_022036, the custom clone sequence may differ by one or more nucleotides


ATGCGGGGGCGTGGCAGTCAACAGCAACAACCCACACGCCGGCAGGGCCAGAAACTCCCATCTCCCTCAC
CAGCCGGAAAGTACGAGTCGGCTCAGCCTGGAGGGACCCAACCAGAGCCTGGCCTGGGAGCCAGGATGGC
CATCCACAAAGCCTTGGTGATGTGCCTGGGACTGCCTCTCTTCCTGTTCCCAGGGGCCTGGGCCCAGGGC
CATGTCCCACCCGGCTGCAGCCAAGGCCTCAACCCCCTGTACTACAACCTGTGTGACCGCTCTGGGGCGT
GGGGCATCGTCCTGGAGGCCGTGGCTGGGGCGGGCATTGTCACCACGTTTGTGCTCACCATCATCCTGGT
GGCCAGCCTCCCCTTTGTGCAGGACACCAAGAAACGGAGCCTGCTGGGGACCCAGGTATTCTTCCTTCTG
GGGACCCTGGGCCTCTTCTGCCTCGTGTTTGCCTGTGTGGTGAAGCCCGACTTCTCCACCTGTGCCTCTC
GGCGCTTCCTCTTTGGGGTTCTGTTCGCCATCTGCTTCTCTTGTCTGGCGGCTCACGTCTTTGCCCTCAA
CTTCCTGGCCCGGAAGAACCACGGGCCCCGGGGCTGGGTGATCTTCACTGTGGCTCTGCTGCTGACCCTG
GTAGAGGTCATCATCAATACAGAGTGGCTGATCATCACCCTGGTTCGGGGCAGTGGCGAGGGCGGCCCTC
AGGGCAACAGCAGCGCAGGCTGGGCCGTGGCCTCCCCCTGTGCCATCGCCAACATGGACTTTGTCATGGC
ACTCATCTACGTCATGCTGCTGCTGCTGGGTGCCTTCCTGGGGGCCTGGCCCGCCCTGTGTGGCCGCTAC
AAGCGCTGGCGTAAGCATGGGGTCTTTGTGCTCCTCACCACAGCCACCTCCGTTGCCATATGGGTGGTGT
GGATCGTCATGTATACTTACGGCAACAAGCAGCACAACAGTCCCACCTGGGATGACCCCACGCTGGCCAT
CGCCCTCGCCGCCAATGCCTGGGCCTTCGTCCTCTTCTACGTCATCCCCGAGGTCTCCCAGGTGACCAAG
TCCAGCCCAGAGCAAAGCTACCAGGGGGACATGTACCCCACCCGGGGCGTGGGCTATGAGACCATCCTGA
AAGAGCAGAAGGGTCAGAGCATGTTCGTGGAGAACAAGGCCTTTTCCATGGATGAGCCGGTTGCAGCTAA
GAGGCCGGTGTCACCATACAGCGGGTACAATGGGCAGCTGCTGACCAGTGTGTACCAGCCCACTGAGATG
GCCCTGATGCACAAAGTTCCGTCCGAAGGAGCTTACGACATCATCCTCCCACGGGCCACCGCCAACAGCC
AGGTGATGGGCAGTGCCAACTCGACCCTGCGGGCTGAAGACATGTACTCGGCCCAGAGCCACCAGGCGGC
CACACCGCCGAAAGACGGCAAGAACTCTCAGGTCTTTAGAAACCCCTACGTGTGGGACTGA


Restriction Sites Please inquire     
ACCN NM_022036
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_022036.2, NP_071319.2
RefSeq Size 2389 bp
RefSeq ORF 1461 bp
Locus ID 55890
UniProt ID Q9NQ84
Domains 7tm_3
Protein Families Druggable Genome, GPCR, Transmembrane
Gene Summary The protein encoded by this gene is a member of the type 3 G protein-coupled receptor family. Members of this superfamily are characterized by a signature 7-transmembrane domain motif. The specific function of this protein is unknown; however, this protein may mediate the cellular effects of retinoic acid on the G protein signal transduction cascade. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) encodes isoform a. Variants 1, 2 and 4 encode isoform a. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. CCDS Note: The coding region has been updated to shorten the N-terminus to one that is more supported by conservation.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...