Glutathione Peroxidase 4 (GPX4) (NM_002085) Human Untagged Clone
CAT#: SC324086
GPX4 (untagged)-Human glutathione peroxidase 4 (phospholipid hydroperoxidase) (GPX4), transcript variant 1 (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below)
CNY 3696.00
CNY 3990.00
Cited in 3 publications. |
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Synonyms | GPx-4; GSHPx-4; MCSP; PHGPx; SMDS; snGPx; snPHGPx |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_002085.3
GAGCGCTCTGGAGGGCGTGGCCGTGGGAAAGGAGGCGCGGAAAGCCGACGCGCGTCCATT
GGTCGGCTGGACGAGGGGAGGAGCCGCTGGCTCCCAGCCCCGCCGCGATGAGCCTCGGCC GCCTTTGCCGCCTACTGAAGCCGGCGCTGCTCTGTGGGGCTCTGGCCGCGCCTGGCCTGG CCGGGACCATGTGCGCGTCCCGGGACGACTGGCGCTGTGCGCGCTCCATGCACGAGTTTT CCGCCAAGGACATCGACGGGCACATGGTTAACCTGGACAAGTACCGGGGCTTCGTGTGCA TCGTCACCAACGTGGCCTCCCAGTGAGGCAAGACCGAAGTAAACTACACTCAGCTCGTCG ACCTGCACGCCCGATACGCTGAGTGTGGTTTGCGGATCCTGGCCTTCCCGTGTAACCAGT TCGGGAAGCAGGAGCCAGGGAGTAACGAAGAGATCAAAGAGTTCGCCGCGGGCTACAACG TCAAATTCGATATGTTCAGCAAGATCTGCGTGAACGGGGACGACGCCCACCCGCTGTGGA AGTGGATGAAGATCCAACCCAAGGGCAAGGGCATCCTGGGAAATGCCATCAAGTGGAACT TCACCAAGTTCCTCATCGACAAGAACGGCTGCGTGGTGAAGCGCTACGGACCCATGGAGG AGCCCCTGGTGATAGAGAAGGACCTGCCCCACTATTTCTAGCTCCACAAGTGTGTGGCCC CGCCCGAGCCCCTGCCCACGCCCTTGGAGCCTTCCACCGGCACTCATGACGGCCTGCCTG CAAACCTGCTGGTGGGGCAGACCCGAAAATCCAGCGTGCACCCCGCCGGAGGAAGGTCCC ATGGCCTGCTGGGCTTGGCTCGGCGCCCCCACCCCTGGCTACCTTGTGGGAATAAACAGA CAAATTAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | ECoRI-NOT |
ACCN | NM_002085 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). The expression of this clone is not guaranteed due to the nature of selenoproteins. |
OTI Annotation | This clone encodes a selenoprotein containing the rare amino acid selenocysteine (Sec). Sec is encoded by UGA codon, which normally signals translational termination. Expression of this clone is not guaranteed due to the nature of selenoproteins. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_002085.3, NP_002076.2 |
RefSeq Size | 942 bp |
Locus ID | 2879 |
UniProt ID | P36969 |
Protein Families | Druggable Genome |
Protein Pathways | Arachidonic acid metabolism, Glutathione metabolism |
Gene Summary | The protein encoded by this gene belongs to the glutathione peroxidase family, members of which catalyze the reduction of hydrogen peroxide, organic hydroperoxides and lipid hydroperoxides, and thereby protect cells against oxidative damage. Several isozymes of this gene family exist in vertebrates, which vary in cellular location and substrate specificity. This isozyme has a high preference for lipid hydroperoxides and protects cells against membrane lipid peroxidation and cell death. It is also required for normal sperm development; thus, it has been identified as a 'moonlighting' protein because of its ability to serve dual functions as a peroxidase, as well as a structural protein in mature spermatozoa. Mutations in this gene are associated with Sedaghatian type of spondylometaphyseal dysplasia (SMDS). This isozyme is also a selenoprotein, containing the rare amino acid selenocysteine (Sec) at its active site. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. Transcript variants resulting from alternative splicing or use of alternate promoters have been described to encode isoforms with different subcellular localization. [provided by RefSeq, Dec 2018] Transcript Variant: This variant (1) represents the predominant transcript and encodes the canonical isoform A. A similar isoform in rat (L-form) has been shown to be localized to the mitochondria (PMID:9988735). CCDS Note: This CCDS ID represents a selenoprotein that is functionally sensitive to selenium levels (e.g., PMID:14642406). Position 73 of the protein is a selenocysteine residue, which is cotranslationally incorporated when a UGA codon, which is normally a stop codon, is recognized by a specific selenocysteyl-tRNA in conjunction with a stem-loop SECIS element in the 3' UTR. |
Citations (3)
The use of this cDNA Clones has been cited in the following citations: |
---|
Targeted reduction of cholesterol uptake in cholesterol-addicted lymphoma cells blocks turnover of oxidized lipids to cause ferroptosis
,null,
The Journal of Biological Chemistry
,PubMed ID 33208460
[GPX4]
|
Anti-Oxidant and Anti-Endothelial Dysfunctional Properties of Nano-Selenium in vitro and in vivo of Hyperhomocysteinemic Rats
,Zheng, Z;Liu, L;Zhou, K;Ding, L;Zeng, J;Zhang, W;,
IJN
,PubMed ID 32606691
[GPX4]
|
The oxido-reductase enzyme glutathione peroxidase 4 (GPX4) governs Salmonella Typhimurium-induced neutrophil transepithelial migration
,Agbor, TA;Demma, Z;Mrsny, RJ;Castillo, A;Boll, EJ;McCormick, BA;,
Cell. Microbiol.
,PubMed ID 24617613
[GPX4]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC208065 | GPX4 (Myc-DDK-tagged)-Human glutathione peroxidase 4 (phospholipid hydroperoxidase) (GPX4), transcript variant 1, (Note, selenocysteine protein, internal stop codon, see reference data summary) |
CNY 2400.00 |
|
RC208065L1 | Lenti-ORF, GPX4 (Myc-DDK-tagged)-Human glutathione peroxidase 4 (phospholipid hydroperoxidase) (GPX4), transcript variant 1, (Note, selenocystein protein, internal stop codon, see summary) |
CNY 4800.00 |
|
RC208065L2 | Lenti-ORF, GPX4 (mGFP-tagged) - Human glutathione peroxidase 4 (phospholipid hydroperoxidase) (GPX4), transcript variant 1, (Note: selenocystein protein, Internal stop codon present. See Summary below) |
CNY 4800.00 |
|
RC208065L3 | Lenti-ORF, GPX4 (Myc-DDK-tagged)-Human glutathione peroxidase 4 (phospholipid hydroperoxidase) (GPX4), transcript variant 1, (Note, selenocystein protein, internal stop codon, see summary) |
CNY 4800.00 |
|
RC208065L4 | Lenti-ORF, GPX4 (mGFP-tagged) - Human glutathione peroxidase 4 (phospholipid hydroperoxidase) (GPX4), transcript variant 1, (Note: selenocystein protein, Internal stop codon present. See Summary below) |
CNY 4800.00 |
|
RG208065 | GPX4 (GFP-tagged) - Human glutathione peroxidase 4 (phospholipid hydroperoxidase) (GPX4), transcript variant 1, (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below) |
CNY 4000.00 |
|
SC118821 | GPX4 (untagged)-Human glutathione peroxidase 4 (phospholipid hydroperoxidase) (GPX4), transcript variant 1 (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below) |
CNY 3696.00 |
其它Glutathione Peroxidase 4产品