MTCH2 (NM_014342) Human Untagged Clone
CAT＃: SC324067
MTCH2 (untagged)-Human mitochondrial carrier 2 (MTCH2), nuclear gene encoding mitochondrial protein
CNY 2400.00
CNY 2950.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | HSPC032; MIMP; SLC25A50 |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_014342.2
GCTTGGTGGCTCCGTCTGTCTGTCCGTCCGCCCGCGGGTGCCATCATGGCGGACGCGGCC
AGTCAGGTGCTCCTGGGCTCCGGTCTCACCATCCTGTCCCAGCCGCTCATGTACGTGAAA GTGCTCATCCAGGTGGGATATGAGCCTCTTCCTCCAACAATAGGACGAAATATTTTTGGG CGGCAAGTGTGTCAGCTTCCTGGTCTCTTTAGTTATGCTCAGCACATTGCCAGTATCGAT GGGAGGCGCGGGTTGTTCACAGGCTTAACTCCAAGACTGTGTTCGGGAGTCCTTGGAACT GTGGTCCATGGTAAAGTTTTACAGCATTACCAGGAGAGTGACAAGGGTGAGGAGTTAGGA CCTGGAAATGTACAGAAAGAAGTCTCATCTTCCTTTGACCACGTTATCAAGGAGACAACT CGAGAGATGATCGCTCGTTCTGCTGCTACCCTCATCACACATCCCTTCCATGTGATCACT CTGAGATCTATGGTACAGTTCATTGGCAGAGAATCCAAGTACTGTGGACTTTGTGATTCC ATAATAACCATCTATCGGGAAGAGGGCATTCTAGGATTTTTCGCGGGTCTTGTTCCTCGC CTTCTAGGTGACATCCTTTCTTTGTGGCTGTGTAACTCACTGGCCTACCTCGTCAATACC TATGCACTGGACAGTGGGGTTTCTACCATGAATGAAATGAAGAGTTATTCTCAAGCTGTC ACAGGATTTTTTGCGAGTATGTTGACCTATCCCTTTGTGCTTGTCTCCAATCTTATGGCT GTCAACAACTGTGGTCTTGCTGGTGGATGCCCTCCTTACTCCCCAATATATACGTCTTGG ATAGACTGTTGGTGCATGCTACAAAAAGAGGGGAATATGAGCCGAGGAAATAGCTTATTT TTCCGGAAGGTCCCCTTTGGGAAGACTTATTGTTGTGACCTGAAAATGTTAATTTGAAGA TGTGGGGCAGGGACAGTGACATTTCTGTAGTCCCAGATGCACAGAATTATGGGAGAGAAT GTTGATTTCTATACAGTGTGGCGCGCTTTTTTAATAATCATTTAATCTTGGGAAAATTCA AAAAAAAAAAAAAAA |
| Restriction Sites | ECoRI-NOT |
| ACCN | NM_014342 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_014342.2, NP_055157.1 |
| RefSeq Size | 2524 bp |
| RefSeq ORF | 912 bp |
| Locus ID | 23788 |
| UniProt ID | Q9Y6C9 |
| Domains | mito_carr |
| Gene Summary | This gene encodes a member of the SLC25 family of nuclear-encoded transporters that are localized in the inner mitochondrial membrane. Members of this superfamily are involved in many metabolic pathways and cell functions. Genome-wide association studies in human have identified single-nucleotide polymorphisms in several loci associated with obesity. This gene is one such locus, which is highly expressed in white adipose tissue and adipocytes, and thought to play a regulatory role in adipocyte differentiation and biology. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. A recent study showed this gene to be an authentic stop codon readthrough target that can produce two isoforms from the same mRNA by use of alternative in-frame translation termination codons. [provided by RefSeq, Dec 2017] Transcript Variant: This variant (1) represents the predominant transcript and encodes two isoforms, which result from the use of alternative in-frame translation termination codons. The shorter isoform (1) results from translation termination at the upstream UGA stop codon, while the longer isoform (1x) results from UGA stop codon readthrough to the downstream UAG termination codon. This RefSeq represents the shorter isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC201473 | MTCH2 (Myc-DDK-tagged)-Human mitochondrial carrier 2 (MTCH2), nuclear gene encoding mitochondrial protein |
CNY 2400.00 |
|
| RC201473L1 | Lenti ORF clone of Human mitochondrial carrier 2 (MTCH2), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged |
CNY 4800.00 |
|
| RC201473L2 | Lenti ORF clone of Human mitochondrial carrier 2 (MTCH2), nuclear gene encoding mitochondrial protein, mGFP tagged |
CNY 5890.00 |
|
| RC201473L3 | Lenti ORF clone of Human mitochondrial carrier 2 (MTCH2), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC201473L4 | Lenti ORF clone of Human mitochondrial carrier 2 (MTCH2), nuclear gene encoding mitochondrial protein, mGFP tagged |
CNY 5890.00 |
|
| RG201473 | MTCH2 (tGFP-tagged) - Human mitochondrial carrier 2 (MTCH2), nuclear gene encoding mitochondrial protein |
CNY 4000.00 |
|
| SC115052 | MTCH2 (untagged)-Human mitochondrial carrier 2 (MTCH2), nuclear gene encoding mitochondrial protein |
CNY 2400.00 |
