SIVA (SIVA1) (NM_021709) Human Untagged Clone
CAT#: SC323987
SIVA1 (untagged)-Human SIVA1, apoptosis-inducing factor (SIVA1), transcript variant 2
CNY 1200.00
CNY 3990.00
Product images
CNY 1999.00
CNY 2700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CD27BP; SIVA; Siva-1; Siva-2 |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_021709.2
GGGCTGGCGGCCGGGGAGCTGCGTAGCTCCCGGCCCCGCGGCCATGCCCAAGCGGAGCTG
CCCCTTCGCGGACGTGGCCCCGCTACAGCTCAAGGTCCGCGTGAGCCAGAGGGAGTTGAG CCGCGGCGTGTGCGCCGAGCGCTACTCGCAGGAGGTCTTCGACCCATCTGGGGTAGCGTC CATTGCCTGTTCCTCATGCGTGCGAGCCGTGGATGGGAAGGCGGTCTGCGGTCAGTGTGA GCGAGCCCTGTGCGGGCAGTGTGTGCGCACCTGCTGGGGCTGCGGCTCCGTGGCCTGTAC CCTGTGTGGCCTCGTGGACTGCAGTGACATGTACGAGAAAGTGCTGTGCACCAGCTGTGC CATGTTCGAGACCTGAGGCTGGCTCAAGCCGGCTGCCTTCACCGGGAGCCACGCCGTGCA TGGCAGCCTTCCCTGGACGAGCGCTCGGTGTTCACACTGAACTGTGGGGTCGACGGGAGG GGTGCCTTTTACATGTTCTATTTTGTATCCTAATGACAGAATGAATAAACCTCTTTATAT TTGCACAAGAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | ECoRI-NOT |
| ACCN | NM_021709 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_021709.2, NP_068355.1 |
| RefSeq Size | 595 bp |
| RefSeq ORF | 333 bp |
| Locus ID | 10572 |
| UniProt ID | O15304 |
| Protein Families | Druggable Genome |
| Gene Summary | This gene encodes an E3 ubiquitin ligase that regulates cell cycle progression, cell proliferation and apoptosis. The N-terminus of this protein binds to the cytoplasmic tail of the CD27 antigen, a member of the tumor necrosis factor receptor (TNFR) superfamily. In response to UV radiation-induced DNA damage, this protein has been shown to mediate the ubiquitination of proliferating cell nuclear antigen (PCNA), an important step in translesion DNA synthesis. [provided by RefSeq, Sep 2018] Transcript Variant: This variant (2) lacks an alternate in-frame segment, compared to variant 1. It appears to lack the apoptotic properties of Siva. The resulting protein (isoform 2) is shorter when it is compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC203748 | SIVA1 (Myc-DDK-tagged)-Human SIVA1, apoptosis-inducing factor (SIVA1), transcript variant 2 |
CNY 1200.00 |
|
| RC203748L1 | Lenti ORF clone of Human SIVA1, apoptosis-inducing factor (SIVA1), transcript variant 2, Myc-DDK-tagged |
CNY 3600.00 |
|
| RC203748L2 | Lenti ORF clone of Human SIVA1, apoptosis-inducing factor (SIVA1), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
| RC203748L3 | Lenti ORF clone of Human SIVA1, apoptosis-inducing factor (SIVA1), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC203748L4 | Lenti ORF clone of Human SIVA1, apoptosis-inducing factor (SIVA1), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
| RG203748 | SIVA1 (tGFP-tagged) - Human SIVA1, apoptosis-inducing factor (SIVA1), transcript variant 2 |
CNY 2800.00 |
|
| SC110171 | SIVA1 (untagged)-Human SIVA1, apoptosis-inducing factor (SIVA1), transcript variant 2 |
CNY 3990.00 |
