PTRH2 (NM_016077) Human Untagged Clone
CAT#: SC323788
PTRH2 (untagged)-Human peptidyl-tRNA hydrolase 2 (PTRH2), nuclear gene encoding mitochondrial protein
CNY 2400.00
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | BIT1; CFAP37; CGI-147; IMNEPD; PTH; PTH 2; PTH2 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_016077.3
AGAAGGGAAGGCGCGAGTGAGGAAAGGAGGTACTGTAGATGCCCTCCAAATCCTTGGTTA
TGGAATATTTGGCTCATCCCAGTACACTCGGCTTGGCTGTTGGAGTTGCTTGTGGCATGT GCCTGGGCTGGAGCCTTCGAGTATGCTTTGGGATGCTCCCCAAAAGCAAGACGAGCAAGA CACACACAGATACTGAAAGTGAAGCAAGCATCTTGGGAGACAGCGGGGAGTACAAGATGA TTCTTGTGGTTCGAAATGACTTAAAGATGGGAAAAGGGAAAGTGGCTGCCCAGTGCTCTC ATGCTGCTGTTTCAGCCTACAAGCAGATTCAAAGAAGAAATCCTGAAATGCTCAAACAAT GGGAATACTGTGGCCAGCCCAAGGTGGTGGTCAAAGCTCCTGATGAAGAAACCCTGATTG CATTATTGGCCCATGCAAAAATGCTGGGACTGACTGTAAGTTTAATTCAAGATGCTGGAC GTACTCAGATTGCACCAGGCTCTCAAACTGTCCTAGGGATTGGGCCAGGACCAGCAGACC TAATTGACAAAGTCACTGGTCACCTAAAACTTTACTAGGTGGACTTTGATATGACAACAA CCCCTCCATCACAAGTGTTTGAAGCCTGTCAGATTCTAACAACAAAAGCTGAATTTCTTC ACCCAACTTAAATGTTCTTGAGATGAAAATAAAACCTATTCCCATGTTCAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | ECoRI-NOT |
ACCN | NM_016077 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_016077.3, NP_057161.1 |
RefSeq Size | 804 bp |
RefSeq ORF | 540 bp |
Locus ID | 51651 |
UniProt ID | Q9Y3E5 |
Protein Families | Transmembrane |
Gene Summary | The protein encoded by this gene is a mitochondrial protein with two putative domains, an N-terminal mitochondrial localization sequence, and a UPF0099 domain. In vitro assays suggest that this protein possesses peptidyl-tRNA hydrolase activity, to release the peptidyl moiety from tRNA, thereby preventing the accumulation of dissociated peptidyl-tRNA that could reduce the efficiency of translation. This protein also plays a role regulating cell survival and death. It promotes survival as part of an integrin-signaling pathway for cells attached to the extracellular matrix (ECM), but also promotes apoptosis in cells that have lost their attachment to the ECM, a process called anoikos. After loss of cell attachment to the ECM, this protein is phosphorylated, is released from the mitochondria into the cytosol, and promotes caspase-independent apoptosis through interactions with transcriptional regulators. This gene has been implicated in the development and progression of tumors, and mutations in this gene have been associated with an infantile multisystem neurologic, endocrine, and pancreatic disease (INMEPD) characterized by intellectual disability, postnatal microcephaly, progressive cerebellar atrophy, hearing impairment, polyneuropathy, failure to thrive, and organ fibrosis with exocrine pancreas insufficiency (PMID: 25574476). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2015] Transcript Variant: This variant (2) lacks an alternate exon in the 5' UTR and uses a downstream start codon compared to variant 1. It encodes isoform b which is one amino acid shorter at the N-terminus compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC201462 | PTRH2 (Myc-DDK-tagged)-Human peptidyl-tRNA hydrolase 2 (PTRH2), nuclear gene encoding mitochondrial protein |
CNY 2400.00 |
|
RC201462L1 | Lenti ORF clone of Human peptidyl-tRNA hydrolase 2 (PTRH2), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged |
CNY 4800.00 |
|
RC201462L2 | Lenti ORF clone of Human peptidyl-tRNA hydrolase 2 (PTRH2), nuclear gene encoding mitochondrial protein, mGFP tagged |
CNY 5890.00 |
|
RC201462L3 | Lenti ORF clone of Human peptidyl-tRNA hydrolase 2 (PTRH2), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged |
CNY 5890.00 |
|
RC201462L4 | Lenti ORF clone of Human peptidyl-tRNA hydrolase 2 (PTRH2), nuclear gene encoding mitochondrial protein, mGFP tagged |
CNY 5890.00 |
|
RG201462 | PTRH2 (tGFP-tagged) - Human peptidyl-tRNA hydrolase 2 (PTRH2), nuclear gene encoding mitochondrial protein |
CNY 4000.00 |