PAX3 (NM_001127366) Human Untagged Clone

CAT#: SC323096

PAX3 (untagged)-Human paired box 3 (PAX3), transcript variant PAX3I



  "NM_001127366" in other vectors (4)

CNY 7220.00


货期*
5周

规格
    • 10 ug

Product images

推荐一起购买 (4)
PAX3 mouse monoclonal antibody,clone OTI4D1
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CDHS; HUP2; WS1; WS3
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001127366, the custom clone sequence may differ by one or more nucleotides
ATGACCACGCTGGCCGGCGCTGTGCCCAGGATGATGCGGCCGGGCCCGGGGCAGAACTAC
CCGCGTAGCGGGTTCCCGCTGGAAGTGTCCACTCCCCTCGGCCAGGGCCGCGTCAACCAG
CTCGGCGGTGTTTTTATCAACGGCAGGCCGCTGCCCAACCACATCCGCCACAAGATCGTG
GAGATGGCCCACCACGGCATCCGGCCCTGCGTCATCTCGCGCCAGCTGCGCGTGTCCCAC
GGCTGCGTCTCCAAGATCCTGTGCAGGTACCAGGAGACTGGCTCCATACGTCCTGGTGCC
ATCGGCGGCAGCAAGCCCAAGGTGACAACGCCTGACGTGGAGAAGAAAATTGAGGAATAC
AAAAGAGAGAACCCGGGCATGTTCAGCTGGGAAATCCGAGACAAATTACTCAAGGACGCG
GTCTGTGATCGAAACACCGTGCCGTCAGTGAGTTCCATCAGCCGCATCCTGAGAAGTAAA
TTCGGGAAAGGTGAAGAGGAGGAGGCCGACTTGGAGAGGAAGGAGGCAGAGGAAAGCGAG
AAGAAGGCCAAACACAGCATCGACGGCATCCTGAGCGAGCGAGCCTCAGCACCCCAATCA
GATGAAGGCTCTGATATTGACTCTGAACCAGATTTACCACTAAAGAGGAAACAGCGCAGA
AGCCGAACCACCTTCACAGCAGAACAGCTGGAGGAACTGGAGCGTGCTTTTGAGAGAACT
CATTACCCTGACATTTATACTAGGGAGGAACTGGCCCAGAGGGCGAAGCTCACCGAGGCC
CGAGTACAGGTCTGGTTTAGCAACCGCCGTGCAAGATGGAGGAAGCAAGCTGGGGCCAAT
CAACTGATGGCTTTCAACCATCTCATTCCCGGGGGGTTCCCTCCCACTGCCATGCCGACC
TTGCCAACGTACCAGCTGTCGGAGACCTCTTACCAGCCCACATCTATTCCACAAGCTGTG
TCAGATCCCAGCAGCACCGTTCACAGACCTCAACCGCTTCCTCCAAGCACTGTACACCAA
AGCACGATTCCTTCCAACCCAGACAGCAGCTCTGCCTACTGCCTCCCCAGCACCAGGCAT
GGATTTTCCAGCTATACAGACAGCTTTGTGCCTCCGTCGGGGCCCTCCAACCCCATGAAC
CCCACCATTGGCAATGGCCTCTCACCTCAGGTAATGGGACTCCTGACCAACCACGGTGGG
GTACCTCATCAGCCCCAGACTGATTACGCGCTCTCCCCTCTCACCGGGGGTCTGGAACCT
ACCACCACGGTGTCGGCCAGCTGCAGTCAGAGACTAGACCATATGAAGAGCTTGGACAGT
CTGCCAACATCTCAGTCCTACTGTCCACCCACCTATAGCACCACAGGCTACAGTATGGAC
CCTGTCACAGGCTACCAATATGGGCAGTATGGACAAAGTGCCTTTCATTATCTCAAGCCA
GATATCGCG
Restriction Sites Please inquire     
ACCN NM_001127366
Insert Size 3356 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001127366.1, NP_001120838.1
RefSeq Size 3356 bp
RefSeq ORF 1452 bp
Locus ID 5077
UniProt ID P23760
Protein Families Adult stem cells, Druggable Genome, Embryonic stem cells, ES Cell Differentiation/IPS, Transcription Factors
Gene Summary This gene is a member of the paired box (PAX) family of transcription factors. Members of the PAX family typically contain a paired box domain and a paired-type homeodomain. These genes play critical roles during fetal development. Mutations in paired box gene 3 are associated with Waardenburg syndrome, craniofacial-deafness-hand syndrome, and alveolar rhabdomyosarcoma. The translocation t(2;13)(q35;q14), which represents a fusion between PAX3 and the forkhead gene, is a frequent finding in alveolar rhabdomyosarcoma. Alternative splicing results in transcripts encoding isoforms with different C-termini. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (PAX3I) differs in the 3' UTR, uses an alternate in-frame splice site in the 5' coding region, and contains an alternate splice pattern in the 3' coding region, compared to variant PAX3. The resulting protein (isoform PAX3i, also known as isoform PAX3dQ-) is longer and has a distinct C-terminus, compared to isoform PAX3. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...