p73 (TP73) (NM_001126241) Human Untagged Clone
CAT＃: SC323069
TP73 (untagged)-Human tumor protein p73 (TP73), transcript variant 3
CNY 3656.00
CNY 7220.00
Product images
CNY 1999.00
CNY 2700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | P73 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_001126241 edited
ATGCTGTACGTCGGTGACCCCGCACGGCACCTCGCCACGGCCCAGTTCAATCTGCTGAGC AGCACCATGGACCAGATGAGCAGCCGCGCGGCCTCGGCCAGCCCCTACACCCCAGAGCAC GCCGCCAGCGTGCCCACCCACTCGCCCTACGCACAACCCAGCTCCACCTTCGACACCATG TCGCCGGCGCCTGTCATCCCCTCCAACACCGACTACCCCGGACCCCACCACTTTGAGGTC ACTTTCCAGCAGTCCAGCACGGCCAAGTCAGCCACCTGGACGTACTCCCCGCTCTTGAAG AAACTCTACTGCCAGATCGCCAAGACATGCCCCATCCAGATCAAGGTGTCCACCCCGCCA CCCCCAGGCACTGCCATCCGGGCCATGCCTGTTTACAAGAAAGCGGAGCACGTGACCGAC GTCGTGAAACGCTGCCCCAACCACGAGCTCGGGAGGGACTTCAACGAAGGACAGTCTGCT CCAGCCAGCCACCTCATCCGCGTGGAAGGCAATAATCTCTCGCAGTATGTGGATGACCCT GTCACCGGCAGGCAGAGCGTCGTGGTGCCCTATGAGCCACCACAGGTGGGGACGGAATTC ACCACCATCCTGTACAACTTCATGTGTAACAGCAGCTGTGTAGGGGGCATGAACCGGCGG CCCATCCTCATCATCATCACCCTGGAGATGCGGGATGGGCAGGTGCTGGGCCGCCGGTCC TTTGAGGGCCGCATCTGCGCCTGTCCTGGCCGCGACCGAAAAGCTGATGAGGACCACTAC CGGGAGCAGCAGGCCCTGAACGAGAGCTCCGCCAAGAACGGGGCCGCCAGCAAGCGTGCC TTCAAGCAGAGCCCCCCTGCCGTCCCCGCCCTTGGTGCCGGTGTGAAGAAGCGGCGGCAT GGAGACGAGGACACGTACTACCTTCAGGTGCGAGGCCGGGAGAACTTTGAGATCCTGATG AAGCTGAAAGAGAGCCTGGAGCTGATGGAGTTGGTGCCGCAGCCACTGGTGGACTCCTAT CGGCAGCAGCAGCAGCTCCTACAGAGGCCGAGTCACCTACAGCCCCCGTCCTACGGGCCG GTCCTCTCGCCCATGAACAAGGTGCACGGGGGCATGAACAAGCTGCCCTCCGTCAACCAG CTGGTGGGCCAGCCTCCCCCGCACAGTTCGGCAGCTACACCCAACCTGGGGCCCGTGGGC CCCGGGATGCTCAACAACCATGGCCACGCAGTGCCAGCCAACGGCGAGATGAGCAGCAGC CACAGCGCCCAGTCCATGGTCTCGGGGTCCCACTGCACTCCGCCACCCCCCTACCACGCC GACCCCAGCCTCGTCAGGACCTGGGGGCCCTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_001126241 |
| Insert Size | 1400 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001126241.1. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001126241.1, NP_001119713.1 |
| RefSeq Size | 2728 bp |
| RefSeq ORF | 1353 bp |
| Locus ID | 7161 |
| UniProt ID | O15350 |
| Protein Families | Druggable Genome, Transcription Factors |
| Protein Pathways | Neurotrophin signaling pathway, p53 signaling pathway |
| Gene Summary | This gene encodes a member of the p53 family of transcription factors involved in cellular responses to stress and development. It maps to a region on chromosome 1p36 that is frequently deleted in neuroblastoma and other tumors, and thought to contain multiple tumor suppressor genes. The demonstration that this gene is monoallelically expressed (likely from the maternal allele), supports the notion that it is a candidate gene for neuroblastoma. Many transcript variants resulting from alternative splicing and/or use of alternate promoters have been found for this gene, but the biological validity and the full-length nature of some variants have not been determined. [provided by RefSeq, Feb 2011] Transcript Variant: This variant (3) differs in the 5' UTR and coding sequence and lacks an alternate coding exon compared to variant 1, that causes a frameshift. The resulting isoform (c, also known as deltaN p73 beta) has a shorter and distinct N-terminus and a shorter and distinct C-terminus compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC225739 | TP73 (Myc-DDK-tagged)-Human tumor protein p73 (TP73), transcript variant 3 |
CNY 3656.00 |
|
| RC225739L3 | Lenti ORF clone of Human tumor protein p73 (TP73), transcript variant 3, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC225739L4 | Lenti ORF clone of Human tumor protein p73 (TP73), transcript variant 3, mGFP tagged |
CNY 5890.00 |
|
| RG225739 | TP73 (tGFP-tagged) - Human tumor protein p73 (TP73), transcript variant 3 |
CNY 4370.00 |
