GFI1 (NM_001127216) Human Untagged Clone

CAT#: SC323046

GFI1 (untagged)-Human growth factor independent 1 transcription repressor (GFI1), transcript variant 3



  "NM_001127216" in other vectors (4)

CNY 7220.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
GFI1 mouse monoclonal antibody, clone OTI6E8 (formerly 6E8)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms GFI-1; GFI1A; SCN2; ZNF163
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC323046 representing NM_001127216.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCCGCGCTCATTTCTCGTCAAAAGCAAGAAGGCTCACAGCTACCACCAGCCGCGCTCCCCAGGACCA
GACTATTCCCTCCGTTTAGAGAATGTACCGGCGCCTAGCCGAGCAGACAGCACTTCAAATGCAGGCGGG
GCGAAGGCGGAGCCCCGGGACCGTTTGTCCCCCGAATCGCAGCTGACCGAAGCCCCAGACAGAGCCTCC
GCATCCCCAGACAGCTGCGAAGGCAGCGTCTGCGAACGGAGCTCGGAGTTTGAGGACTTCTGGAGGCCC
CCGTCACCCTCCGCGTCTCCAGCCTCGGAGAAGTCAATGTGCCCATCGCTGGACGAAGCCCAGCCCTTC
CCCCTGCCTTTCAAACCGTACTCATGGAGCGGCCTGGCGGGTTCTGACCTGCGGCACCTGGTGCAGAGC
TACCGACCGTGTGGGGCCCTGGAGCGTGGCGCTGGCCTGGGCCTCTTCTGCGAACCCGCCCCGGAGCCT
GGCCACCCGGCCGCGCTGTACGGCCCGAAGCGGGCTGCCGGCGGCGCGGGGGCCGGGGCGCCAGGGAGC
TGCAGCGCAGGGGCCGGTGCCACCGCTGGCCCTGGCCTAGGGCTCTACGGCGACTTCGGGTCTGCGGCA
GCCGGGCTGTATGAGAGGCCCACGGCAGCGGCGGGCTTGCTGTACCCCGAGCGTGGCCACGGGCTGCAC
GCAGACAAGGGCGCTGGCGTCAAGGTGGAGTCGGAGCTGCTGTGCACCCGCCTGCTGCTGGGCGGCGGC
TCCTACAAGTGCATCAAGTGCAGCAAGGTGTTCTCCACGCCGCACGGGCTCGAGGTGCACGTGCGCAGG
TCCCACAGCGGTACCAGACCCTTTGCCTGCGAGATGTGCGGCAAGACCTTCGGGCACGCGGTGAGCCTG
GAGCAGCACAAAGCCGTGCACTCGCAGGAACGGAGCTTTGACTGTAAGATCTGTGGGAAGAGCTTCAAG
AGGTCATCCACACTGTCCACACACCTGCTTATCCACTCAGACACTCGGCCCTACCCCTGTCAGTACTGT
GGCAAGAGGTTCCACCAGAAGTCAGACATGAAGAAACACACTTTCATCCACACTGGTGAGAAGCCTCAC
AAGTGCCAGGTGTGCGGCAAGGCATTCAGCCAGAGCTCCAACCTCATCACCCACAGCCGCAAACACACA
GGCTTCAAGCCCTTCGGCTGCGACCTCTGTGGGAAGGGTTTCCAGAGGAAGGTGGACCTCCGAAGGCAC
CGGGAGACGCAGCATGGGCTCAAATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001127216
Insert Size 1269 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001127216.1
RefSeq Size 2709 bp
RefSeq ORF 1269 bp
Locus ID 2672
UniProt ID Q99684
Protein Families Druggable Genome, Transcription Factors
MW 45.3 kDa
Gene Summary This gene encodes a nuclear zinc finger protein that functions as a transcriptional repressor. This protein plays a role in diverse developmental contexts, including hematopoiesis and oncogenesis. It functions as part of a complex along with other cofactors to control histone modifications that lead to silencing of the target gene promoters. Mutations in this gene cause autosomal dominant severe congenital neutropenia, and also dominant nonimmune chronic idiopathic neutropenia of adults, which are heterogeneous hematopoietic disorders that cause predispositions to leukemias and infections. Multiple alternatively spliced variants, encoding the same protein, have been identified for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants 1, 2 and 3 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...