KLLN (NM_001126049) Human Untagged Clone
CAT#: SC322869
KLLN (untagged)-Human killin, p53-regulated DNA replication inhibitor (KLLN)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CWS4; KILLIN |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC322869 representing NM_001126049.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGATCGCCCGGGGCCAGGCTCCGCGCGCCCCGGCCGGACCGTGCACGTTTGGGGTTACCGGGTTGAG TGGAAAGTACGGAACGGTAGGAAGCTGCAGCCCAGCGAGTGGGCGGGGCGAGGAGACCTAGGAGGGTTC AAAAGGAGGTGGAAGGATACACGGGCCACAGTCGGAACTACTTTCCGAAGGAGGTCACGTGTGTCCCTA GTTGGGGAACTTTCCAAATTCCCACTCCCCAGTGATAGCTCCGGAGGCAAGTCGTCTTCTTCCTTTGCT CGGGGTGCTCTTGCCTGGTGCAGGCAGCGGAACCCCAACCCTTCCTGCGCCGCGGCGGAAACAGGGGCT CGGACCAGCCTCCCGAAGGAGCGCTGTCGGGGCTGGCGCTTGGGGAACTGGTTACACAAGCACCCACAT CCAAACACGTGCCCCCGCCTCCCCGCCTGCTGGCTGCCGCCGATTCTTACAGAACGCGGGGAGAGAGTC CCCAAACTGGTGCCACTCCTCGCCTGCTACCCTAAGAGCAAGCCAAAGGACTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001126049 |
| Insert Size | 537 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001126049.1 |
| RefSeq Size | 4277 bp |
| RefSeq ORF | 537 bp |
| Locus ID | 100144748 |
| UniProt ID | B2CW77 |
| MW | 20 kDa |
| Gene Summary | The protein encoded by this intronless gene is found in the nucleus, where it can inhibit DNA synthesis and promote S phase arrest coupled to apoptosis. The expression of this DNA binding protein is upregulated by transcription factor p53. [provided by RefSeq, Dec 2012] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC225189 | KLLN (Myc-DDK-tagged)-Human killin, p53-regulated DNA replication inhibitor (KLLN) |
CNY 2400.00 |
|
| RC225189L3 | Lenti ORF clone of Human killin, p53-regulated DNA replication inhibitor (KLLN), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC225189L4 | Lenti ORF clone of Human killin, p53-regulated DNA replication inhibitor (KLLN), mGFP tagged |
CNY 5890.00 |
|
| RG225189 | KLLN (tGFP-tagged) - Human killin, p53-regulated DNA replication inhibitor (KLLN) |
CNY 4370.00 |
