PSF3 (GINS3) (NM_001126130) Human Untagged Clone
CAT#: SC322848
GINS3 (untagged)-Human GINS complex subunit 3 (Psf3 homolog) (GINS3), transcript variant 3
CNY 3990.00
Product images
CNY 1999.00
CNY 2700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | PSF3 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC322848 representing NM_001126130.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTCAGAGGCTTATTTCCGAGTGGAGTCGGGTGCGCTGGGGCCTGAGGAGAACTTTCTTTCTTTGGAC GACATCCTGATGTCCCACGAGAAGCTGCCGGTGCGCACGGAGACCGCCATGCCTCGCCTTGGCGCTTTC TTCCTGGAGCGGAGCGCAGGCGCCGAGACTGACAACGCGGTCCCACAGACTTTTATCGGACGTTTTCGC CGCATCATGGACTCCTCACAGAATGCTTACAACGAAGACACTTCAGCCCTGGTAGCCAGGCTAGACGAG ATGGAGAGGGGCTTATTTCAAACAGGGCAGAAAGGACTGAATGACTTTCAGTGTTGGGAGAAGGGGCAG GCTTCTCAGATCACAGCTTCCAACCTCGTTCAGAATTACAAGAAGAGAAAATTCACTGATATGGAAGAC TGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001126130 |
| Insert Size | 417 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001126130.1 |
| RefSeq Size | 2063 bp |
| RefSeq ORF | 417 bp |
| Locus ID | 64785 |
| UniProt ID | Q9BRX5 |
| MW | 15.7 kDa |
| Gene Summary | This gene encodes a protein subunit of the GINS heterotetrameric complex, which is essential for the initiation of DNA replication and replisome progression in eukaryotes. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3) lacks two alternate in-frame exons, compared to variant 1, resulting in a shorter protein (isoform c), compared to isoform a. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC225114 | GINS3 (Myc-DDK-tagged)-Human GINS complex subunit 3 (Psf3 homolog) (GINS3), transcript variant 3 |
CNY 1200.00 |
|
| RC225114L3 | Lenti-ORF clone of GINS3 (Myc-DDK-tagged)-Human GINS complex subunit 3 (Psf3 homolog) (GINS3), transcript variant 3 |
CNY 5890.00 |
|
| RC225114L4 | Lenti-ORF clone of GINS3 (mGFP-tagged)-Human GINS complex subunit 3 (Psf3 homolog) (GINS3), transcript variant 3 |
CNY 5890.00 |
|
| RG225114 | GINS3 (tGFP-tagged) - Human GINS complex subunit 3 (Psf3 homolog) (GINS3), transcript variant 3 |
CNY 4370.00 |
