serum amyloid A2 (SAA2) (NM_001127380) Human Untagged Clone

CAT#: SC322799

SAA2 (untagged)-Human serum amyloid A2 (SAA2), transcript variant 2



  "NM_001127380" in other vectors (4)

CNY 1200.00

CNY 3990.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
SAA2 Antibody - C-terminal region
    • 100 ul

CNY 5250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms SAA; SAA1
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_001127380 edited
ATGAAGCTTCTCACGGGCCTGGTTTTCTGCTCCTTGGTCCTGAGTGTCAGCAGCCGAAGC
TTCTTTTCGTTCCTTGGCGAGGCTTTTGATGGGGCTCGGGACATGTGGAGAGCCTACTCT
GACATGAGAGAAGCCAATTACATCGGCTCAGACAAATACTTCCATGCTCGGGGGAACTAT
GATGCTGCCAAAAGGGGACCTGGGGGTGCCTGGGCTGCAGAAGTGATCAGTTTATTTTCA
GCTGAACTGTAG
Restriction Sites Please inquire     
ACCN NM_001127380
Insert Size 2053 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001127380.1, NP_001120852.1
RefSeq Size 2053 bp
RefSeq ORF 252 bp
Locus ID 6289
UniProt ID P02735
Protein Families Druggable Genome
Gene Summary This gene encodes a member of the serum amyloid A family of apolipoproteins. The encoded preproprotein is proteolytically processed to generate the mature protein. This protein is a major acute phase protein that is highly expressed in response to inflammation and tissue injury. This protein also plays an important role in HDL metabolism and cholesterol homeostasis. High levels of this protein are associated with chronic inflammatory diseases including atherosclerosis, rheumatoid arthritis, Alzheimer's disease and Crohn's disease. This protein may also be a potential biomarker for certain tumors. Finally, antimicrobial activity against S. aureus and E. coli resides in the N-terminal portion of the mature protein. [provided by RefSeq, Jul 2020]
Transcript Variant: This variant (2) has an alternate 3' exon, as compared to variant 1. The resulting isoform (b) has a shorter and different C-terminus, as compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...