Neurogranin (NRGN) (NM_001126181) Human Untagged Clone

CAT#: SC322795

NRGN (untagged)-Human neurogranin (protein kinase C substrate, RC3) (NRGN), transcript variant 2



  "NM_001126181" in other vectors (4)

CNY 3990.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
NRGN mouse monoclonal antibody,clone OTI1A2
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms hng; RC3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC322795 representing NM_001126181.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGACTGCTGCACCGAGAACGCCTGCTCCAAGCCGGACGACGACATTCTAGACATCCCGCTGGACGAT
CCCGGCGCCAACGCGGCCGCCGCCAAAATCCAGGCGAGTTTTCGGGGCCACATGGCGCGGAAGAAGATA
AAGAGCGGAGAGCGCGGCCGGAAGGGCCCGGGCCCTGGGGGGCCTGGCGGAGCTGGGGTGGCCCGGGGA
GGCGCGGGCGGCGGCCCCAGCGGAGACTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001126181
Insert Size 237 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001126181.1
RefSeq Size 1238 bp
RefSeq ORF 237 bp
Locus ID 4900
UniProt ID Q92686
Protein Families Druggable Genome
MW 7.6 kDa
Gene Summary Neurogranin (NRGN) is the human homolog of the neuron-specific rat RC3/neurogranin gene. This gene encodes a postsynaptic protein kinase substrate that binds calmodulin in the absence of calcium. The NRGN gene contains four exons and three introns. The exons 1 and 2 encode the protein and exons 3 and 4 contain untranslated sequences. It is suggested that the NRGN is a direct target for thyroid hormone in human brain, and that control of expression of this gene could underlay many of the consequences of hypothyroidism on mental states during development as well as in adult subjects. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) uses an alternate splice acceptor site in a 3' UTR exon.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...